View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20595_high_10 (Length: 230)
Name: NF20595_high_10
Description: NF20595
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20595_high_10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 119; Significance: 6e-61; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 12 - 146
Target Start/End: Complemental strand, 11723169 - 11723035
Alignment:
| Q |
12 |
gattattctatgtggtagtttttgggtttttcttaatttgtagtactgaagtgttttatggggagttatggtttgttcttgttgctgcctcctgttgctt |
111 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
11723169 |
gattatgctatgtggtagtttttgggtttttcttaatctgtagtactgaagtgttttatggggagttatgatttgttcttgttgctgcctcctgttgctt |
11723070 |
T |
 |
| Q |
112 |
ttacaagttgtaattgtttggtggactaagcgtgt |
146 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| |
|
|
| T |
11723069 |
ttacaagttgtaattgtttggtggactaatcgtgt |
11723035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 66 - 141
Target Start/End: Original strand, 11594214 - 11594289
Alignment:
| Q |
66 |
tttatggggagttatggtttgttcttgttgctgcctcctgttgct-tttacaagttgtaattgtttggtggactaag |
141 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||| |||||||| ||||| |||||||||||| ||||||||||| |
|
|
| T |
11594214 |
tttatgaggagttatggtttgttcttgttgctgcct-ctgttgctctttaccagttgtaattgtggggtggactaag |
11594289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 10 - 71
Target Start/End: Original strand, 11613560 - 11613620
Alignment:
| Q |
10 |
tagattattctatgtggtagtttttgggtttttcttaatttgtagtactgaagtgttttatg |
71 |
Q |
| |
|
|||||||| |||||||||||||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
11613560 |
tagattatgctatgtggtagtttttgg-tttttcttaaactgtagtactgaagtgttttatg |
11613620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 66 - 141
Target Start/End: Original strand, 11606130 - 11606205
Alignment:
| Q |
66 |
tttatggggagttatggtttgttcttgttgctgcctcctgttgc-ttttacaagttgtaattgtttggtggactaag |
141 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||| |||||| |||||| ||||||||||| ||||||||||| |
|
|
| T |
11606130 |
tttatgaggagttatggtttgttcttgttgctgcct-atgttgctttttacctgttgtaattgtggggtggactaag |
11606205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University