View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20595_high_6 (Length: 279)
Name: NF20595_high_6
Description: NF20595
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20595_high_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 20 - 269
Target Start/End: Original strand, 30768362 - 30768611
Alignment:
| Q |
20 |
cgaggcgatcttgaacatcgtagaattcgatggctgtgtgtgctgagagtcgaaccctgcgatcgcgaggaccttttgatgtgtaaaccttgctgtgacg |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30768362 |
cgaggcgatcttgaacatcgtagaattcgatggctgtgtgtgctgagagtcgaaccctgcgatcgcgaggaccttttgatgtgtaaaccttgctgtgacg |
30768461 |
T |
 |
| Q |
120 |
atcttttttaccggtggctcgaactatgtgtcctccttctacttgaactatctctcctccagtactcctcatccctagttctcaccttctctatgctttc |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
30768462 |
atcttttttaccggtggctcgaactatgtgtcctccttctacttgaactatctctcctccagtactcctcatccctagttcccaccttctctatgctttc |
30768561 |
T |
 |
| Q |
220 |
tatggaaagttgtttctatttggtggggttggttttgggcttattgatga |
269 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30768562 |
tatgaaaagttgtttctatttggtggggttggttttgggcttattgatga |
30768611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 28 - 179
Target Start/End: Original strand, 39077344 - 39077495
Alignment:
| Q |
28 |
tcttgaacatcgtagaattcgatggctgtgtgtgctgagagtcgaaccctgcgatcgcgaggaccttttgatgtgtaaaccttgctgtgacgatcttttt |
127 |
Q |
| |
|
||||||||||| ||||||| || |||||||||||||| | |||||| | ||||| ||||||||||| | ||||| ||||| || || | |||||| |
|
|
| T |
39077344 |
tcttgaacatcatagaattgaattgctgtgtgtgctgataatcgaacacgtcgatcacgaggacctttcgcagtgtataccttactatgtctgtcttttc |
39077443 |
T |
 |
| Q |
128 |
taccggtggctcgaactatgtgtcctccttctacttgaactatctctcctcc |
179 |
Q |
| |
|
|||| || || | || ||||| ||||||| ||||||||||| |||||||| |
|
|
| T |
39077444 |
tacctgtcgcccttacaatgtggcctccttgaacttgaactatttctcctcc |
39077495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University