View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20595_high_9 (Length: 251)
Name: NF20595_high_9
Description: NF20595
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20595_high_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 107; Significance: 1e-53; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 18 - 128
Target Start/End: Complemental strand, 4163763 - 4163653
Alignment:
| Q |
18 |
gtttctaggtgttctttatacttaccacaataggccaaatattgagggcacatgctgccaaagaatttagctcacattcatctggtccattctgccaagt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4163763 |
gtttctaggtgttctttatacttaccacattaggccaaatattgagggcacatgctgccaaagaatttagctcacattcatctggtccattctgccaagt |
4163664 |
T |
 |
| Q |
118 |
tgattgtgtga |
128 |
Q |
| |
|
||||||||||| |
|
|
| T |
4163663 |
tgattgtgtga |
4163653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 191 - 237
Target Start/End: Complemental strand, 4163589 - 4163543
Alignment:
| Q |
191 |
cctggcatgaaatggcattgttggtttgattgacatgagaattggcc |
237 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4163589 |
cctgacatgaaatggcattgttggtttgattgacatgagaattggcc |
4163543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University