View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20596_high_17 (Length: 381)
Name: NF20596_high_17
Description: NF20596
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20596_high_17 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 191; Significance: 1e-103; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 191; E-Value: 1e-103
Query Start/End: Original strand, 1 - 191
Target Start/End: Original strand, 1328631 - 1328821
Alignment:
| Q |
1 |
atgagcaagagatattcttctcaactcgacgtgggactcgccttctcaacatgtccgattttcgtgacagctcacaatctggttcgtgggacttctctgc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1328631 |
atgagcaagagatattcttctcaactcgacgtgggactcgccttctcaacatgtccgattttcgtgacagctcacaatctggttcgtgggacttctctgc |
1328730 |
T |
 |
| Q |
101 |
atttgtgcgcacatattcgttatatttggatgagaggcttgagtacaagatgcaaagtcggcgtggaaagcgtagcatgtttggttatgac |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1328731 |
atttgtgcgcacatattcgttatatttggatgagaggcttgagtacaagatgcaaagtcggcgtggaaagcgtagcatgtttggttatgac |
1328821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 111; E-Value: 6e-56
Query Start/End: Original strand, 256 - 366
Target Start/End: Original strand, 1328904 - 1329014
Alignment:
| Q |
256 |
tcgttgtaagatccacaccagtgcgtgaaatgaagttagagcaaattttttccaaaatgcagcatttgcaattgcttcttgaacgctttttagcttgtcg |
355 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1328904 |
tcgttgtaagatccacaccagtgcgtgaaatgaagttagagcaaattttttccaaaatgcagcatttgcaattgcttcttgaacgctttttagcttgtcg |
1329003 |
T |
 |
| Q |
356 |
ccccacaggtt |
366 |
Q |
| |
|
||||||||||| |
|
|
| T |
1329004 |
ccccacaggtt |
1329014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 1923954 - 1924015
Alignment:
| Q |
1 |
atgagcaagagatattcttctcaactcgacgtgggactcgccttctcaacatgtccgatttt |
62 |
Q |
| |
|
|||| ||||| |||||||||||||||| |||||| ||||| ||||| |||||||| |||||| |
|
|
| T |
1923954 |
atgaacaagaaatattcttctcaactcaacgtggaactcgacttcttaacatgtctgatttt |
1924015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University