View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20596_high_30 (Length: 239)
Name: NF20596_high_30
Description: NF20596
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20596_high_30 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 44575062 - 44575282
Alignment:
| Q |
1 |
tgctttatgaacaatgttgacaattaaggaaccagtgtagtttgcaatggacaggctcaaaaagaagatggcaccagaaacagtcctcatagactccggc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44575062 |
tgctttatgaacaatgttgacaattaaggaaccagtgtagtttgcaatggacaggctcaaaaagaagatggcaccagaaacagtcctcatagactccggc |
44575161 |
T |
 |
| Q |
101 |
acttgaagggtaaagaattccattatagcaacagcagcaaaggcttcatttaaaccggacagcgcaaactgcggcaagagcaaaccaaagctcacaggcg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44575162 |
acttgaagggtaaagaattccattatagcaacagcagcaaaggcttcatttaaaccggacagcgcaaactgcggcaagagcaaaccaaagctcacaggcg |
44575261 |
T |
 |
| Q |
201 |
aaataaacgaattgtgtttca |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
44575262 |
aaataaacgaattgtgtttca |
44575282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University