View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20596_high_32 (Length: 238)
Name: NF20596_high_32
Description: NF20596
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20596_high_32 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 219; Significance: 1e-120; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 16 - 238
Target Start/End: Complemental strand, 41297559 - 41297337
Alignment:
| Q |
16 |
cagctgcaactatgcagaacacaagcagaacaggcgtcatgatcatcgccaccttcacctgcaaattataaatgatgaaaactttagacatgttgataga |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41297559 |
cagctgcaactatgcagaacacaagcagaacaggtgtcatgatcatcgccaccttcacctgcaaattataaatgatgaaaactttagacatgttgataga |
41297460 |
T |
|
| Q |
116 |
tgatggtgcttaacatatgtttggtattatgtagttgtgccagaatcacgacgacctatcgtgatttgtcaaaagttatagagtgtggtttggaaaatca |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41297459 |
tgatggtgcttaacatatgtttggtattatgtagttgtgccagaatcacgacgacctatcgtgatttgtcaaaagttatagagtgtggtttggaaaatca |
41297360 |
T |
|
| Q |
216 |
tgatgggttgtcccgattttaac |
238 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
41297359 |
tgatgggttgtcccgattttaac |
41297337 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 26 - 75
Target Start/End: Complemental strand, 41307366 - 41307317
Alignment:
| Q |
26 |
tatgcagaacacaagcagaacaggcgtcatgatcatcgccaccttcacct |
75 |
Q |
| |
|
||||||||||||||| |||||||| ||| ||||||| || |||||||||| |
|
|
| T |
41307366 |
tatgcagaacacaagtagaacaggtgtcgtgatcatagctaccttcacct |
41307317 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University