View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20596_high_33 (Length: 221)
Name: NF20596_high_33
Description: NF20596
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20596_high_33 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 184; Significance: 1e-100; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 184; E-Value: 1e-100
Query Start/End: Original strand, 22 - 205
Target Start/End: Complemental strand, 51719986 - 51719803
Alignment:
| Q |
22 |
gatggtgttgaatttgaaggtacatgggtgactgcaagtgcacatatcataacagcagtgataggatcaggagtgttatcacttgcatgggcaatagctc |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51719986 |
gatggtgttgaatttgaaggtacatgggtgactgcaagtgcacatatcataacagcagtgataggatcaggagtgttatcacttgcatgggcaatagctc |
51719887 |
T |
|
| Q |
122 |
aaatgggttggattgctggcccagcagttctacttgctttctcttttataacttatttcacttccactcttcttgctgattctt |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51719886 |
aaatgggttggattgctggcccagcagttctacttgctttctcttttataacttatttcacttccactcttcttgctgattctt |
51719803 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 51 - 140
Target Start/End: Original strand, 40203596 - 40203685
Alignment:
| Q |
51 |
gactgcaagtgcacatatcataacagcagtgataggatcaggagtgttatcacttgcatgggcaatagctcaaatgggttggattgctgg |
140 |
Q |
| |
|
|||||||||||||||| | |||||||| |||||||| || |||||| | || || || ||||| || |||||| | || ||||||||||| |
|
|
| T |
40203596 |
gactgcaagtgcacatgtaataacagctgtgatagggtctggagtgctgtctctagcttgggctattgctcaacttggatggattgctgg |
40203685 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 73; Significance: 2e-33; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 30 - 202
Target Start/End: Complemental strand, 315274 - 315102
Alignment:
| Q |
30 |
tgaatttgaaggtacatgggtgactgcaagtgcacatatcataacagcagtgataggatcaggagtgttatcacttgcatgggcaatagctcaaatgggt |
129 |
Q |
| |
|
|||||||||||| |||||| | ||||| ||||||||||| ||||| || ||||| || || ||||| ||||||| |||||||||||||| ||||||||| |
|
|
| T |
315274 |
tgaatttgaagggacatggttaactgctagtgcacatattataacggctgtgattggttctggagttctatcactagcatgggcaatagcacaaatgggt |
315175 |
T |
|
| Q |
130 |
tggattgctggcccagcagttctacttgctttctcttttataacttatttcacttccactcttcttgctgatt |
202 |
Q |
| |
|
||| | ||||| || |||||||| |||| || ||||| || || |||||||||||||||||||||||||||| |
|
|
| T |
315174 |
tgggtagctggtcctgcagttctctttgcattttctttcattacctatttcacttccactcttcttgctgatt |
315102 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 36 - 137
Target Start/End: Complemental strand, 47911119 - 47911018
Alignment:
| Q |
36 |
tgaaggtacatgggtgactgcaagtgcacatatcataacagcagtgataggatcaggagtgttatcacttgcatgggcaatagctcaaatgggttggatt |
135 |
Q |
| |
|
|||||| ||||||||||||||||||||||| || | || || || |||||||| |||||||| ||| | |||||||| | || ||| ||||||||||| |
|
|
| T |
47911119 |
tgaaggaacatgggtgactgcaagtgcacacatagtgactgctgtaataggatctggagtgttgtcattggcatgggctgttgcacaattgggttggatt |
47911020 |
T |
|
| Q |
136 |
gc |
137 |
Q |
| |
|
|| |
|
|
| T |
47911019 |
gc |
47911018 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University