View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20596_high_34 (Length: 207)
Name: NF20596_high_34
Description: NF20596
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20596_high_34 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 173; Significance: 3e-93; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 1 - 202
Target Start/End: Original strand, 11030335 - 11030542
Alignment:
| Q |
1 |
ttagtagaactctaaatataagaagtgtttctcactcaaatagctgggtatgtttgagttctactagtagaactgtgttcataattcaccatcttttatc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11030335 |
ttagtagaactctaaatataagaagtgtttctcactcaaatagctgggtatgtttgagttctactagtagaactgtgttcataattcaccatcttttatc |
11030434 |
T |
 |
| Q |
101 |
aatcaaaatgattccttttgagcttttacctcatgattattgatat------tttctctctcttatgagtatgatttataaccctctcaagtctcatcct |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11030435 |
aatcaaaatgattccttttgagcttttacctcatgattattcatatgctgtctttctctctcttatgagtatgatttataaccctctcaagtctcatccc |
11030534 |
T |
 |
| Q |
195 |
atgcttct |
202 |
Q |
| |
|
||| |||| |
|
|
| T |
11030535 |
atgattct |
11030542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 70; E-Value: 9e-32
Query Start/End: Original strand, 1 - 183
Target Start/End: Complemental strand, 10977632 - 10977444
Alignment:
| Q |
1 |
ttagtagaactctaaatataagaagtgtttctcactcaaatagctgggtatgtttgagttctactagtagaact---gtgttcataattcaccatctttt |
97 |
Q |
| |
|
|||||||| ||||||||||||| |||| ||||||||||||| ||| ||| ||||||||||| ||||| ||| |||||||| |||||||| ||||| |
|
|
| T |
10977632 |
ttagtagatctctaaatataag---tgttcctcactcaaatagttgg-tatttttgagttctattagtaaaacaatcgtgttcatgattcaccacctttt |
10977537 |
T |
 |
| Q |
98 |
atcaatcaaaa-tgattccttttgagcttttacctcatgattattgatat------tttctctctcttatgagtatgatttataaccctctca |
183 |
Q |
| |
|
||||||||||| | | |||||||||||||||||||| |||||||| |||| ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
10977536 |
atcaatcaaaaattactccttttgagcttttacctcgtgattattcatatgctccctttctctctcttaagagtatgatttataaccctctca |
10977444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 114 - 183
Target Start/End: Complemental strand, 10932111 - 10932036
Alignment:
| Q |
114 |
ccttttgagcttttacctcatgattattgatat------tttctctctcttatgagtatgatttataaccctctca |
183 |
Q |
| |
|
||||||||||||||||||||| || ||| |||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10932111 |
ccttttgagcttttacctcattataattcatatgctcgctttctctctcttatgagtatgatttataaccctctca |
10932036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University