View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20596_low_10 (Length: 437)

Name: NF20596_low_10
Description: NF20596
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20596_low_10
NF20596_low_10
[»] chr1 (1 HSPs)
chr1 (1-425)||(18714573-18714993)
[»] chr4 (2 HSPs)
chr4 (103-230)||(46609956-46610083)
chr4 (103-236)||(6519328-6519461)
[»] chr5 (2 HSPs)
chr5 (103-427)||(12237613-12237941)
chr5 (314-425)||(9594768-9594879)
[»] chr8 (1 HSPs)
chr8 (103-194)||(25720710-25720801)
[»] chr2 (2 HSPs)
chr2 (183-235)||(20122861-20122913)
chr2 (302-338)||(33412252-33412288)


Alignment Details
Target: chr1 (Bit Score: 341; Significance: 0; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 341; E-Value: 0
Query Start/End: Original strand, 1 - 425
Target Start/End: Original strand, 18714573 - 18714993
Alignment:
1 tcaatgagcccaaggatcctcatcaccaccaacaagaataacaacacacgtcggataccgagttttnnnnnnnnnnnnnnnncaataacaacacacggtg 100  Q
    |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||                  |||||||||||||||||    
18714573 tcaatgagcccaaggagcctcatcaccaccaacaagaataacaacacacgtcggataccgagtttacaaaaaaaaataa----aataacaacacacggtg 18714668  T
101 caggaggtggttattacatccttctcatcgttacacagtgcgggaggcttacaactttctcaccaacaatggtaacccggtggacaggtcgatggtagtt 200  Q
    ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
18714669 caggaggtggttattacatccttctcatcgttacacagttcgggaggcttacaactttctcaccaacaatggtaacccggtggacaggtcgatggtagtt 18714768  T
201 gatgtatggcacaagtttatcccttcaaaggtgtctgtttgtggcgcttcctacagaatagattgcccacacgagataatttggtgcggcgacgtgctct 300  Q
    ||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |    
18714769 gatgtatggcacaagtttatcccttcaaaggtgtctgttcgtggcgcttcctacggaatagattgcccacacgagataatttggtgcggcgacgtgcttt 18714868  T
301 gctgatatcagactcggtttgtgtgtttggttgcggtgaaccagaaaccgcatcccatttattttttggttgcaacacttttagtttgctttggtcccat 400  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
18714869 gctgatatctgactcggtttgtgtgtttggttgcggtgaaccagaaaccgcatcccatttattttttggttgcaacacttttagtttgctttggtcccat 18714968  T
401 gtgttacattggatgggtctttctg 425  Q
    |||||||||||||||||||||||||    
18714969 gtgttacattggatgggtctttctg 18714993  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 80; Significance: 2e-37; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 103 - 230
Target Start/End: Complemental strand, 46610083 - 46609956
Alignment:
103 ggaggtggttattacatccttctcatcgttacacagtgcgggaggcttacaactttctcaccaacaatggtaacccggtggacaggtcgatggtagttga 202  Q
    ||||||||||| |||||||||||||| ||||||| |||||||| |||||| |||||||||||||||| |||||||||||| | ||||||||||||| |||    
46610083 ggaggtggttactacatccttctcatggttacacggtgcgggaagcttaccactttctcaccaacaacggtaacccggtgtataggtcgatggtagatga 46609984  T
203 tgtatggcacaagtttatcccttcaaag 230  Q
    ||||||||| |||| ||| |||||||||    
46609983 tgtatggcataagtatattccttcaaag 46609956  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 103 - 236
Target Start/End: Complemental strand, 6519461 - 6519328
Alignment:
103 ggaggtggttattacatccttctcatcgttacacagtgcgggaggcttacaactttctcaccaacaatggtaacccggtggacaggtcgatggtagttga 202  Q
    |||||||| | ||| |||||||| || ||||||  |||||||| ||||||  |||||||||  |||| |||| |||| |||||| ||||| ||| | |||    
6519461 ggaggtggcttttaaatccttctaatggttacaaggtgcgggaagcttactgctttctcacttacaacggtagcccgatggacaagtcgacggtggatga 6519362  T
203 tgtatggcacaagtttatcccttcaaaggtgtct 236  Q
    ||| ||||| |||  ||| |||||||||||||||    
6519361 tgtttggcataagagtattccttcaaaggtgtct 6519328  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 60; Significance: 2e-25; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 103 - 427
Target Start/End: Original strand, 12237613 - 12237941
Alignment:
103 ggaggtggttattacatccttctcatcgttacacagtgcgggaggcttacaactttctcaccaacaatggtaacccggtggacaggtcgatggtagttga 202  Q
    |||| ||||||||||||||||||||| |||||||||| |||||| | ||    |||||||| ||||||||||||| ||||| ||||||| |||||| |||    
12237613 ggagatggttattacatccttctcatggttacacagtacgggagtcatatcgttttctcacaaacaatggtaacctggtgggcaggtcgttggtagatga 12237712  T
203 tgtatggcacaagtttatcccttcaaaggtgtctgttt----gtggcgcttcctacagaatagattgcccacacgagataatttggtgcggcgacgtgct 298  Q
    ||| ||||| |||| ||||||||| ||||| ||| | |    ||||||| | ||   ||| | |||| | ||  ||||||||||||| | |||||| |||    
12237713 tgtgtggcataagtctatcccttcgaaggtatctttgttcgcgtggcgccttctctggaacaaattgtctactagagataatttggttcagcgacgagct 12237812  T
299 ctgctgatatcagactcggtttgtgtgtttggttgcggtgaaccagaaaccgcatcccatttattttttggttgcaacacttttagtttgctttggtccc 398  Q
     |||| |||||  || | ||||| |||| ||| |||||| || ||||||| ||   ||||||||| |||||||| || || || |   | |||||||| |    
12237813 ttgcttatatctcacgctgtttgcgtgtctggctgcggtcaaacagaaactgcggtccatttattctttggttgtaatacgttcaacgtactttggtcgc 12237912  T
399 atgtgttacattggatgggtctttctgtg 427  Q
    |||||||||| ||| ||||||| ||||||    
12237913 atgtgttacaatggttgggtctctctgtg 12237941  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 314 - 425
Target Start/End: Original strand, 9594768 - 9594879
Alignment:
314 tcggtttgtgtgtttggttgcggtgaaccagaaaccgcatcccatttattttttggttgcaacacttttagtttgctttggtcccatgtgttacattgga 413  Q
    ||||||||||| | ||||||||||||| || |||||| | |||||||||||||| ||||||||| | | |||||||||||| | |||||||||||||||     
9594768 tcggtttgtgtatctggttgcggtgaatcaaaaaccgtagcccatttattttttagttgcaacattctcagtttgctttggactcatgtgttacattggt 9594867  T
414 tgggtctttctg 425  Q
    || |||| ||||    
9594868 tgagtctctctg 9594879  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 103 - 194
Target Start/End: Original strand, 25720710 - 25720801
Alignment:
103 ggaggtggttattacatccttctcatcgttacacagtgcgggaggcttacaactttctcaccaacaatggtaacccggtggacaggtcgatg 194  Q
    ||||||||||| || ||||||||||| ||||||| ||  |||| ||||||  |||||| ||||| |||||||||   ||||| |||||||||    
25720710 ggaggtggttactagatccttctcatggttacacggttagggaagcttaccgctttcttaccaataatggtaactttgtggataggtcgatg 25720801  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 29; Significance: 0.0000006; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 183 - 235
Target Start/End: Original strand, 20122861 - 20122913
Alignment:
183 gacaggtcgatggtagttgatgtatggcacaagtttatcccttcaaaggtgtc 235  Q
    ||||||||| |||| | |||||| |||||||||||||| || |||||||||||    
20122861 gacaggtcgttggttgatgatgtgtggcacaagtttattccctcaaaggtgtc 20122913  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 302 - 338
Target Start/End: Original strand, 33412252 - 33412288
Alignment:
302 ctgatatcagactcggtttgtgtgtttggttgcggtg 338  Q
    |||||| ||||||||||||||||||| ||||||||||    
33412252 ctgatagcagactcggtttgtgtgttaggttgcggtg 33412288  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University