View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20597_low_4 (Length: 332)
Name: NF20597_low_4
Description: NF20597
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20597_low_4 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 242; Significance: 1e-134; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 14 - 287
Target Start/End: Original strand, 42640570 - 42640842
Alignment:
| Q |
14 |
atatattatctgttacggatacaagtacaattaagtgattcaagttgatcggttggaattaataatgtcttaaatgttttgatttatttattggtagaaa |
113 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||| ||||||||||||||| |
|
|
| T |
42640570 |
atatatgatctgttacggatacaagtacaattaagtgattcaagttgatcggttggaattattaatgtcttgaatgttttgatt-atttattggtagaaa |
42640668 |
T |
|
| Q |
114 |
cccctgaaaataaattgtgacaagggtaacttaggtgtccttacaaatcaatttgcggaggtcaaaatctctgtaaattagtttagtcaatgcaaacata |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42640669 |
cccctgaaaataaattgtgacaagggtaacttaggtgtccttacgaatcaatttgtggaggtcaaaatctctgtaaattagtttagtcaatgcaaacata |
42640768 |
T |
|
| Q |
214 |
tactatgtatgtgttgcgaatacaagtagtggattcgactggaattgataatgattacgtagctatttatgttt |
287 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42640769 |
tactatgtatgtgttgcgaatacaagtagtggaatcgactggaattgataatgattacgtagctatttatgttt |
42640842 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 285 - 332
Target Start/End: Original strand, 42641017 - 42641064
Alignment:
| Q |
285 |
ttttggccaaacgttttaagttatttcttactagaaactcacgcaaat |
332 |
Q |
| |
|
|||||| |||||||||||| |||||||||||||||||||| ||||||| |
|
|
| T |
42641017 |
ttttggacaaacgttttaatttatttcttactagaaactcccgcaaat |
42641064 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University