View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20597_low_5 (Length: 315)
Name: NF20597_low_5
Description: NF20597
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20597_low_5 |
 |  |
|
| [»] scaffold0003 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0003 (Bit Score: 258; Significance: 1e-144; HSPs: 1)
Name: scaffold0003
Description:
Target: scaffold0003; HSP #1
Raw Score: 258; E-Value: 1e-144
Query Start/End: Original strand, 19 - 300
Target Start/End: Original strand, 343297 - 343577
Alignment:
| Q |
19 |
ataagcccttgttttgaagttacgaaccgtctttccagtaagtacgtcgatttttaaagttactgtgcattagtttttgacatatggtttcagtttagct |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
343297 |
ataagcccttgttttgaagttacgaaccgtctttccagtaagtacgtcgatttttaaagttactgtgcactagtttttgacatatggtttcagtttagct |
343396 |
T |
 |
| Q |
119 |
ttaacctaggatttcagttctcacttgttacattgtactgatatctaattaggaatgcatcattttgcttctcaggaagctaaggttgcttacaccgggg |
218 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
343397 |
tcaacctaggatttcagttctcacttgttacattgtactgatatctaattagggatgcatcattttgcttctcaggaagctaaggttgcttacaccgggg |
343496 |
T |
 |
| Q |
219 |
agaaccatctgcgccgagaatgtgaaaaatgggaaaaatgttgcttcctcgttatagtgatcatgtcagtttatgacctttg |
300 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
343497 |
agaaccatctgcgccgagaaagtgaaaaatggg-aaaatgttgcttcctcgttatagtgatcatgtcagtttatgacctttg |
343577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University