View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20598_high_33 (Length: 249)
Name: NF20598_high_33
Description: NF20598
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20598_high_33 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 18 - 249
Target Start/End: Complemental strand, 23368820 - 23368595
Alignment:
| Q |
18 |
catcaatgtatgttgatgatgtcaacagattaatgatatggcccaagtaagttagatgcactaatttataagcataaaaataatttaatgtcttactgcc |
117 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23368820 |
catcagtgtatgttgatgatgtcaacagattaatgatatggcccaagtaagttagatgcactaatttataagcataaaaataatttaatgtcttactgcc |
23368721 |
T |
 |
| Q |
118 |
agaaggaacaatttcaatgttcgtaatgttggatagcggacttctttgtaaggttattggttgagatgattctgccaccttcctcttgcacaaaatggta |
217 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
23368720 |
agaaggaacatattcaatgttcgtaatgttggatagcggacttctttgtaaggttattggttgagatga------caccttcctcttgcacaaaatggta |
23368627 |
T |
 |
| Q |
218 |
tgatttagtgttgatggaactgttaaaatatt |
249 |
Q |
| |
|
||| |||||||||||||||||||||||||||| |
|
|
| T |
23368626 |
tgacttagtgttgatggaactgttaaaatatt |
23368595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University