View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20598_high_39 (Length: 224)
Name: NF20598_high_39
Description: NF20598
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20598_high_39 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 49; Significance: 3e-19; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 159 - 224
Target Start/End: Original strand, 275284 - 275353
Alignment:
| Q |
159 |
taaaaactcttaaagctgacagtgtatatgaattaaagcc----ataaattataacaagagaattatata |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||| |
|
|
| T |
275284 |
taaaaactcttaaagctgacagtgtatatgaattaaacccataaataaattataacaagagaattatata |
275353 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University