View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20598_low_18 (Length: 382)
Name: NF20598_low_18
Description: NF20598
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20598_low_18 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 94; Significance: 9e-46; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 94; E-Value: 9e-46
Query Start/End: Original strand, 235 - 372
Target Start/End: Complemental strand, 36446279 - 36446142
Alignment:
| Q |
235 |
ccaaacttaaattatctaagnnnnnnnngataagagttgaaccaagtacatcatataatcaatagtatagggatagggagtatcataagtaataggtagt |
334 |
Q |
| |
|
|||||||||||||||||||| |||||||||| ||||||||| ||||||||||||||||||| || |||||||||||||||||||||||||||| |
|
|
| T |
36446279 |
ccaaacttaaattatctaagataaaaaagataagagttaaaccaagtagatcatataatcaatagtatgggtatagggagtatcataagtaataggtagt |
36446180 |
T |
 |
| Q |
335 |
atcacatgttcttttttggttacagtatcacaggttct |
372 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
36446179 |
atcacaggttcttttttggttacagtatcacaggttct |
36446142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 79; E-Value: 8e-37
Query Start/End: Original strand, 4 - 98
Target Start/End: Complemental strand, 36446479 - 36446387
Alignment:
| Q |
4 |
gtagtatcataggttccactcctttgctcactctcttccaatctttttcaaattaaaattggtagggtcatgttaaaggaaattttaacatgtgc |
98 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
36446479 |
gtagtatcataggttccactcctt-gctcactctcttccaatctttttcaaattaaaattggtagggtcatgtt-aaggaaattttaacatgtgc |
36446387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University