View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20598_low_41 (Length: 214)

Name: NF20598_low_41
Description: NF20598
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20598_low_41
NF20598_low_41
[»] chr1 (1 HSPs)
chr1 (18-193)||(25138545-25138718)


Alignment Details
Target: chr1 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 18 - 193
Target Start/End: Complemental strand, 25138718 - 25138545
Alignment:
18 atgaagtaaaagaacaaaatgtttatcttcaattccctttcttaaagtctgcgaaaggtgcaaatgtatgtggaaactttgtctcaatcctaaattgttg 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
25138718 atgaagtaaaagaacaaaatgtttatcttcaattccctttcttaaagtctgcgaaaggtgcaaatgtatgtggaaactttgtctcaatcctaaattgttg 25138619  T
118 tcttttgtagatgccaaaatataatagcatctttgaggggggcttcatctcttaattcccttttgtttaaaaacga 193  Q
    ||||||||||||||||||  ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
25138618 tcttttgtagatgccaaa--ataatagcatctttgagaggggcttcatctcttaattcccttttgtttaaaaacga 25138545  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University