View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2059_low_12 (Length: 238)

Name: NF2059_low_12
Description: NF2059
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2059_low_12
NF2059_low_12
[»] chr3 (1 HSPs)
chr3 (17-238)||(4259661-4259882)


Alignment Details
Target: chr3 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 17 - 238
Target Start/End: Original strand, 4259661 - 4259882
Alignment:
17 aagacccatcagcaaaagctttgacaccaccaaaataaacccattgacttaaggcatgaccctttttattaatcagatcctaagtaggaatgggaataat 116  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4259661 aagacccatcagcaaaagctttgacaccaccaaaataaacccattgacttaaggcatgaccctttttattaatcagatcctaagtaggaatgggaataat 4259760  T
117 ggtattcagaattcagctacataaaaattagcaatattggaaatgtaaaattcaaaatgtagaaaatttgttcttcaataattcttttggtaagtgaaga 216  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
4259761 ggtattcagaattcagctacataaaaattagcaatattggaaatgtaaaattcaaaatgcagaaaatttgttcttcaataattcttttggtaagtgaaga 4259860  T
217 gtttcatttgcatgccaagcat 238  Q
    ||||||||||||||||||||||    
4259861 gtttcatttgcatgccaagcat 4259882  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University