View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20600_high_1 (Length: 358)
Name: NF20600_high_1
Description: NF20600
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20600_high_1 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 248; Significance: 1e-137; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 248; E-Value: 1e-137
Query Start/End: Original strand, 93 - 348
Target Start/End: Original strand, 32982277 - 32982532
Alignment:
| Q |
93 |
gcataggagatatgggatgggattaccctcttattaattcctatatgtattaattataactgaatcttatcacagccatctccaagttgccctgataaat |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32982277 |
gcataggagatatgggatgggattaccctcttattaattcctatatgtattaattataactgaatcttatcacagccatctccaagttgccctgataaat |
32982376 |
T |
 |
| Q |
193 |
cttcactacttctatactccgcagtgtccacaacattcatatcagcctcagctgtggttgtctctgtcaccaattgtacagttttctttgttgcatccca |
292 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
32982377 |
cttcactacttctatactccacagtgtccacaacattcatatcagcctcagctgtggttgtctcagtcaccaattgtacagttttctttgttgcatccca |
32982476 |
T |
 |
| Q |
293 |
tgcagtttccacattttccttaccaacttcttcaagtacctctcttgcattctctg |
348 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32982477 |
tgcagtttccacattttccttaccaacttcttcaagtacctctcttgcattctctg |
32982532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 100; Significance: 2e-49; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 208 - 327
Target Start/End: Original strand, 27037952 - 27038071
Alignment:
| Q |
208 |
actccgcagtgtccacaacattcatatcagcctcagctgtggttgtctctgtcaccaattgtacagttttctttgttgcatcccatgcagtttccacatt |
307 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
27037952 |
actccgcagtgtccacggcattcatatcagcctcagcagtggttgtctctgtcaccaattgtacagtgttctttgtagcatcccatgcagtttccacatt |
27038051 |
T |
 |
| Q |
308 |
ttccttaccaacttcttcaa |
327 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
27038052 |
ttccttaccaacttcttcaa |
27038071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University