View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20600_high_2 (Length: 250)

Name: NF20600_high_2
Description: NF20600
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20600_high_2
NF20600_high_2
[»] chr6 (1 HSPs)
chr6 (30-250)||(182161-182374)


Alignment Details
Target: chr6 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 30 - 250
Target Start/End: Original strand, 182161 - 182374
Alignment:
30 gttgattgaatattgaaaaatatgaagtgtacaaa-tatgattgatgtcgagaacaatgatttaatggtacgtgattaattgaatattacaactaactaa 128  Q
    ||||||||||||||||||||||||||||||||||| ||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
182161 gttgattgaatattgaaaaatatgaagtgtacaaaatatcattgatgtcgacaacaatgatttaatggtacgtgattaattgaatattacaactaactaa 182260  T
129 caaacaacacactcttcaattctgtcattctcattctgtgtgcagaagcacaattttaaatttattattattaatataatatgcaacttggtttttgacc 228  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||        ||||||||||||||||||||||||    
182261 caaacaacacactcttcaattctgtcatcctcattctgtgtgcagaagcacaattttaaatttattat--------taatatgcaacttggtttttgacc 182352  T
229 ataaatattaacattaaccaca 250  Q
    ||||||||||||||||||||||    
182353 ataaatattaacattaaccaca 182374  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University