View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20600_low_5 (Length: 240)
Name: NF20600_low_5
Description: NF20600
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20600_low_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 19 - 228
Target Start/End: Complemental strand, 54498818 - 54498609
Alignment:
| Q |
19 |
atagttactctgggagtaacttgatcccacctcaaagaacctgatgtttctggcttggcagcgaggaactggcttatatagaaaataagatcctttgtga |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54498818 |
atagttactctgggagtaacttgatcccacctcaaagaacatgatgtttctggcttggcagcgaggaactggcttatatagaaaataagatcctttgtga |
54498719 |
T |
 |
| Q |
119 |
tacgtactaacatcatgtttagtttctattaattaattgtttgctttacttctacatgcgatttgggggtgagttctggtttcattatgctttcaacatt |
218 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54498718 |
tacgtactaacagcatgtttagtttctattaattaattgtttgctttacttctacatgcgatttgggggtgagttctggtttcattatgctttcaacatt |
54498619 |
T |
 |
| Q |
219 |
tcaatctgtg |
228 |
Q |
| |
|
|||||||||| |
|
|
| T |
54498618 |
tcaatctgtg |
54498609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 179 - 228
Target Start/End: Complemental strand, 19257704 - 19257655
Alignment:
| Q |
179 |
atttgggggtgagttctggtttcattatgctttcaacatttcaatctgtg |
228 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
19257704 |
atttgggggtgagttctggttccattatgctttcaacatttcaatctgtg |
19257655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University