View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20602_low_7 (Length: 323)
Name: NF20602_low_7
Description: NF20602
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20602_low_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 90; Significance: 2e-43; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 205 - 306
Target Start/End: Complemental strand, 14987525 - 14987425
Alignment:
| Q |
205 |
aaagtgagctgaatttgaaaaagggatcattgtcacttttttgtgttcatatattagtcctctagataaataataatctaagtggattgaatgtttttaa |
304 |
Q |
| |
|
||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14987525 |
aaagtgagctgaatttgcaaa-gggatcattgtcacttttttgtgttcatatattagtcctctagataaataataatctaagtggattgaatgtttttaa |
14987427 |
T |
 |
| Q |
305 |
tt |
306 |
Q |
| |
|
|| |
|
|
| T |
14987426 |
tt |
14987425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 10 - 107
Target Start/End: Complemental strand, 14987627 - 14987531
Alignment:
| Q |
10 |
attattctcacactattgtttttatattatctagtatcaatagaaatattcaaatggagggaaatattattgttttctaactaatattacaaaaatga |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14987627 |
attattctcacactattgtttttatattatcaagtatcaatagaaaaattcaaatgg-gggaaatattattgttttctaactaatattacaaaaatga |
14987531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University