View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20603_low_3 (Length: 355)
Name: NF20603_low_3
Description: NF20603
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20603_low_3 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 139; Significance: 1e-72; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 139; E-Value: 1e-72
Query Start/End: Original strand, 5 - 155
Target Start/End: Complemental strand, 32952610 - 32952460
Alignment:
| Q |
5 |
agaatatcagatagttaacataaaaaataatattagttattaaatatcacgtgaaggctaacacaactttcaacttcaatttagtgaaaaacaatggagg |
104 |
Q |
| |
|
|||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32952610 |
agaaaatcaaatagttaacataaaaaataatattagttattaaatatcacgtgaaggctaacacaactttcaacttcaatttagtgaaaaacaatggagg |
32952511 |
T |
 |
| Q |
105 |
aaaaatgcagtcgtgaagataatagattgttgtgatttttgacgaagttac |
155 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
32952510 |
aaaaatgcagtcgtgaagataatacattgttgtgatttttgacgaagttac |
32952460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 278 - 338
Target Start/End: Complemental strand, 32952335 - 32952275
Alignment:
| Q |
278 |
cagcggaggaaaacacaggcaagatcaagacaaacaaaaacttctaagatatactttcttt |
338 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32952335 |
cagcggaggaaaacacaggcaagatcaagacaaacaaaaacttctaagatatactttcttt |
32952275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University