View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20605_high_5 (Length: 328)
Name: NF20605_high_5
Description: NF20605
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20605_high_5 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 192; Significance: 1e-104; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 4 - 207
Target Start/End: Complemental strand, 1786799 - 1786596
Alignment:
| Q |
4 |
tccgtcgagcagagttgaaagttcgttgttccgttacaattcaatttaatttccgtttgttcgttttttacactttcttgatttggactgtgaaatcgtt |
103 |
Q |
| |
|
||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1786799 |
tccgtcgtgaagagttgaaagttcgttgttccgttacaattcaatttaatttccgtttgttcgttttttacactttcttgatttggactgtgaaatcgtt |
1786700 |
T |
|
| Q |
104 |
tgatattgactgagtgcgtgctattttatatgatcattgcgttttctgtgagtttcagcttctttggattcggttctgttgtgagattaggtaacgtagt |
203 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1786699 |
tgatattgactgagtgcgtgcgattttatatgatcattgcgttttctgtgagtttcagcttctttggattcggttctgttgtgagattaggtaacgtagt |
1786600 |
T |
|
| Q |
204 |
ttgg |
207 |
Q |
| |
|
|||| |
|
|
| T |
1786599 |
ttgg |
1786596 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 252 - 308
Target Start/End: Complemental strand, 1786560 - 1786504
Alignment:
| Q |
252 |
gaagctgtttttggttgaatttttattgaagttttgcatattctgatgtgatgatgt |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
1786560 |
gaagctgtttttggttgaatttttattgaagttttgcatattctgatgtgttgatgt |
1786504 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University