View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20605_low_1 (Length: 307)
Name: NF20605_low_1
Description: NF20605
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20605_low_1 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 81; Significance: 4e-38; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 120 - 208
Target Start/End: Complemental strand, 34660210 - 34660122
Alignment:
| Q |
120 |
gctttaatcgaacccaaatcttgaacataaacgtgtagaaagaggacataaattgaaatccgagaatgaacgacgggttctaataggag |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||| |
|
|
| T |
34660210 |
gctttaatcgaacccaaatcttgaacataaacgtgtagaaagaggacataaattgaaatctgagaatgaacgatgggttctaataggag |
34660122 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 1 - 59
Target Start/End: Complemental strand, 34660329 - 34660271
Alignment:
| Q |
1 |
agtaatagtcaaacttatcgtgaaatcaagttgaaattgcaacccataaatcggagcag |
59 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34660329 |
agtaatagtcaaacttatcgtgaaatcaagttgaaattgcaacccataaatcggagcag |
34660271 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University