View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20606_low_6 (Length: 324)
Name: NF20606_low_6
Description: NF20606
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20606_low_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 285; Significance: 1e-160; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 285; E-Value: 1e-160
Query Start/End: Original strand, 14 - 306
Target Start/End: Original strand, 45344770 - 45345062
Alignment:
| Q |
14 |
gagatgtttgaaaataaaaaaggtgacatgggattggtgataaaggacatgtgatccaaaggccatgatgtttctaaatctaggtcaaaatccatagaac |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45344770 |
gagatgtttgaaaataaaaaaggtgacatgggattggtgataaaggacatgtgatccaaaggccatgatgtttctaaatctaggtcaaaatccatagaac |
45344869 |
T |
 |
| Q |
114 |
aaccatgttcttctaatgatgtttttgtcttgggaggaaagtcttgattttcttcttcaggttctgacattttttctcaagattctgtttgtgggtgtga |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
45344870 |
aaccatgttcttctaatgatgtttttgtcttgggaggaaagtcttgattttcttcttcaggttctgacattttttctcaagatcctgtttgtgggtgtga |
45344969 |
T |
 |
| Q |
214 |
tgcaaaagtgataaagattggaactttgtgtagaacaatttcagcaaaggaaatgaaaacaaatgggtagattgaagaatgcatagatagtat |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
45344970 |
tgcaaaagtgataaagattggaactttgtgtagaacaatttcagcaaaggaaatgaaaacaaatgggtaaattgaagaatgcatagatagtat |
45345062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University