View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20606_low_9 (Length: 245)
Name: NF20606_low_9
Description: NF20606
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20606_low_9 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 107; Significance: 9e-54; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 124 - 234
Target Start/End: Original strand, 31015678 - 31015788
Alignment:
| Q |
124 |
atgatggaatgagggagttttgcttgtctttgttttgcgcgattggaggagtggtggaagagtttgtggaaccgaaattgagatccgaagaccctgcaaa |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
31015678 |
atgatggaatgagggagttttgcttgtctttgttttgcgcgattggaggagtggtggaagagtttgtggaatcgaaattgagatccgaagaccctgcaaa |
31015777 |
T |
|
| Q |
224 |
atcgccatttt |
234 |
Q |
| |
|
||||||||||| |
|
|
| T |
31015778 |
atcgccatttt |
31015788 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 125 - 234
Target Start/End: Original strand, 31193840 - 31193949
Alignment:
| Q |
125 |
tgatggaatgagggagttttgcttgtctttgttttgcgcgattggaggagtggtggaagagtttgtggaaccgaaattgagatccgaagaccctgcaaaa |
224 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
31193840 |
tgatggaatgaggaagttttgcttgtctttgttttgcctgattggaggagtggtggaagagtttgtgaaagcgaaattgagatccgaagaccctgcaaaa |
31193939 |
T |
|
| Q |
225 |
tcgccatttt |
234 |
Q |
| |
|
|||||||||| |
|
|
| T |
31193940 |
tcgccatttt |
31193949 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 31015555 - 31015613
Alignment:
| Q |
1 |
aaattgaaatcatcgatcaaacacacattgaacatgaactcgaagtatagtaatcgtgc |
59 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31015555 |
aaattgaaatcatcgatcaaacacacattgaacatgaactcgaagtatagtaatcgtgc |
31015613 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 35
Target Start/End: Original strand, 31193709 - 31193743
Alignment:
| Q |
1 |
aaattgaaatcatcgatcaaacacacattgaacat |
35 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |
|
|
| T |
31193709 |
aaattgaaatcatcgatcaaacacgcattgaacat |
31193743 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University