View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20607_low_5 (Length: 250)
Name: NF20607_low_5
Description: NF20607
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20607_low_5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 139; Significance: 8e-73; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 139; E-Value: 8e-73
Query Start/End: Original strand, 13 - 206
Target Start/End: Original strand, 32225849 - 32226035
Alignment:
| Q |
13 |
aatattagtcattaacagtctcaattgaagataggctcaggaatattaggcataagcagtctcaactggagctggagcatacattaatggattaacaatt |
112 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
32225849 |
aatattagtcattaacggtctcaattgaagataggctcaggaatattaggcataagcaatctcaactgg------agcatacattaatggattaacaatt |
32225942 |
T |
|
| Q |
113 |
taatatcacatcttctcaaaggatccatttacgggtaggtcctacaacaaaggtggctaaacaacatgcagagctgtctttcaattaacctgac |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||| |||||||||| |||||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
32225943 |
taatatcacatcttctcaaaggatccatttatgggtaggtcatacaacaaagatggctaaacaacatgc-gagttgtctttcaattaacctgac |
32226035 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 13 - 201
Target Start/End: Original strand, 1659570 - 1659752
Alignment:
| Q |
13 |
aatattagtcattaacagtctcaattgaagataggctcaggaatattaggcataagcagtctcaactggagctggagcatacattaatggattaacaatt |
112 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||| |||| |||| |||||||||||||||||||||| |
|
|
| T |
1659570 |
aatattagtcattaacggtctcaattgaagataggctcacgaatattaggcataagcagtcttaactagagc------atacattaatggattaacaatt |
1659663 |
T |
|
| Q |
113 |
taatatcacatcttctcaaaggatccatttacgggtaggtcctacaacaaaggtggctaaacaacatgcagagctgtctttcaattaac |
201 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
1659664 |
taatatcacatcttctcaaaggattcatttacgggtaggtcctacaacaaagatggctaaacaacatccagagttgtctttcaattaac |
1659752 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University