View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20608_high_21 (Length: 250)
Name: NF20608_high_21
Description: NF20608
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20608_high_21 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 141; Significance: 5e-74; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 43 - 243
Target Start/End: Original strand, 280331 - 280530
Alignment:
| Q |
43 |
tagtgcatatgaaatataaaataaaatagatattatatttagctcgtctcatcaaaattgaacaactatgaatacgccaaatacatgaatgcaatattta |
142 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||| ||||||| |
|
|
| T |
280331 |
tagtgcatataaaatataaaataaaatagatattatatttagctcgtctcatcaaaatcgaacaactatggatacgccaaatacatgaatgcgatattta |
280430 |
T |
 |
| Q |
143 |
tccaattacaacgaattctatttttcgataagacacattcaattatattattttttaaaattataaatcgacgtgtcagtgttattatcatattcatctc |
242 |
Q |
| |
|
||||| ||||||||||| |||||||||||| |||||||| |||||||||||||||||| | |||| || ||||||||||||| | ||||||||||||||| |
|
|
| T |
280431 |
tccaactacaacgaattttatttttcgatatgacacatttaattatattattttttaaga-tatatattgacgtgtcagtgtcagtatcatattcatctc |
280529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University