View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20608_low_18 (Length: 256)
Name: NF20608_low_18
Description: NF20608
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20608_low_18 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 119; Significance: 7e-61; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 119; E-Value: 7e-61
Query Start/End: Original strand, 124 - 242
Target Start/End: Complemental strand, 7721309 - 7721191
Alignment:
| Q |
124 |
cccttcttctgaaggtgtctagttttggtcggggacatgagtgtttggagtggtcttgctgtgatacatggagttgttttgtctttactgttctagttgt |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7721309 |
cccttcttctgaaggtgtctagttttggtcggggacatgagtgtttggagtggtcttgctgtgatacatggagttgttttgtctttactgttctagttgt |
7721210 |
T |
|
| Q |
224 |
gcaagtatagagttgtttt |
242 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
7721209 |
gcaagtatagagttgtttt |
7721191 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 1 - 56
Target Start/End: Complemental strand, 7721433 - 7721378
Alignment:
| Q |
1 |
cccattatgggcttgtgtgttgtttcagtctgtaggcattttgttgctagaatttg |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7721433 |
cccattatgggcttgtgtgttgtttcagtctgtaggcattttgttgctagaatttg |
7721378 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University