View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20609_low_7 (Length: 323)
Name: NF20609_low_7
Description: NF20609
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20609_low_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 166; Significance: 8e-89; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 166; E-Value: 8e-89
Query Start/End: Original strand, 85 - 290
Target Start/End: Complemental strand, 50789267 - 50789064
Alignment:
| Q |
85 |
attttgtactttacgcgttgagctgaaaaactgaactttgttgtttcaaaccttggaagtggatttttgctttcgattcatattaaattaaatttagaat |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50789267 |
attttgtactttacgcgttgagctgaaaaactgaactttgttgtttcaaaccttggaagtggatttttgctttcgattcatattaaattaaatttagaat |
50789168 |
T |
|
| Q |
185 |
ggtctcaaattttctgcattttgacagtgatttttatatcatgttttagctnnnnnnnnnttgtacacttctaagaagtcttagatgttaatatctctac |
284 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
50789167 |
ggtctcaaatattctgcattttgacagtgatttttatatcatgttttagct--aaaaaaattgtacacttctaagaagtcttagatgttaatatctttac |
50789070 |
T |
|
| Q |
285 |
atacat |
290 |
Q |
| |
|
|||||| |
|
|
| T |
50789069 |
atacat |
50789064 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 26 - 63
Target Start/End: Complemental strand, 50789763 - 50789726
Alignment:
| Q |
26 |
aaatttggcaaatgttgtaagttatttggtcccaaatt |
63 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50789763 |
aaatttggcaaatgttgtaagttatttggtcccaaatt |
50789726 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University