View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2060_high_14 (Length: 289)
Name: NF2060_high_14
Description: NF2060
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2060_high_14 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 160; Significance: 3e-85; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 160; E-Value: 3e-85
Query Start/End: Original strand, 1 - 289
Target Start/End: Original strand, 43775120 - 43775407
Alignment:
| Q |
1 |
aagttttgctgaatcatggagaagcactcaggaagacagtactcaaccatggccctatttgaatgaagctctcacaaaattccaggcatgtaaatgcctc |
100 |
Q |
| |
|
|||||||| ||||||||||||||||| ||||| |||||||||| |||||||||||||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
43775120 |
aagttttggtgaatcatggagaagcattcaggcagacagtactgaaccatggccctatttgaatgaagctcttgcgaaattccaggcatgtaaatgccta |
43775219 |
T |
 |
| Q |
101 |
ttcattatattgactttagctagagcaattgttgaatttacattaaataagtgtataatattcacaattgctttgaataannnnnnnnnncttctggcaa |
200 |
Q |
| |
|
| | |||||||| ||||||||||| ||| ||||||||||||||||| ||||||||||||||||||||||||| ||||| || || || |
|
|
| T |
43775220 |
tgctttatattggctttagctagaataatagttgaatttacattaaagaagtgtataatattcacaattgcttcaaataaattttttct--ttttgacac |
43775317 |
T |
 |
| Q |
201 |
cctttcacatgatgact-tttcactcaaacccccattctatgttcctgtcaaatctccaggaccctgcagaggctgataagttgttgaaa |
289 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43775318 |
cctttcacatgatgactgtttcactcaaacccccattttatgttcctgtcaaatctccaggaccctgcagaggctgataagttgttgaaa |
43775407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University