View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2060_low_18 (Length: 309)
Name: NF2060_low_18
Description: NF2060
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2060_low_18 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 275; Significance: 1e-154; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 275; E-Value: 1e-154
Query Start/End: Original strand, 16 - 298
Target Start/End: Complemental strand, 37199890 - 37199608
Alignment:
| Q |
16 |
aagttgatggcggatttggttgagaagtgtagggttttgagaggtggggcaatggcaggtgcgattcatttacacgctagacatggggatccgatggttc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37199890 |
aagttgatggcggatttggttgagaagtgtagggttttgagaggtggggcgatggcaggtgcgattcatttacacgctagacatggggatccgatggttc |
37199791 |
T |
|
| Q |
116 |
atgagtttatgaagaggttgcttcagcgtgtgtgttctccgctttttgaaatggtgaagaggtgggttttggaaggggagttggaagatatttttgttga |
215 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37199790 |
atgagtttatgaagaggttgcttcggcgtgtgtgttctccgctttttgaaatggtgaagaggtgggttttggaaggggagttggaagatatttttgttga |
37199691 |
T |
|
| Q |
216 |
gtttttcattgttgggcagcctgtgaaagctgaatcgctttggagagagggatatcggctctatgatgctatgcttccttctt |
298 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37199690 |
gtttttcattgttgggcagcctgtgaaagctgaatcgctttggagagagggatatcggctctatgatgctatgcttccttctt |
37199608 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University