View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2060_low_32 (Length: 216)
Name: NF2060_low_32
Description: NF2060
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2060_low_32 |
 |  |
|
| [»] scaffold0110 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0110 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: scaffold0110
Description:
Target: scaffold0110; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 7 - 201
Target Start/End: Original strand, 3786 - 3980
Alignment:
| Q |
7 |
gagtgagaagaaaaatggtaatggatttcaaggtcttggtggatgttctaagtgcttgaatagtctctatttggtgagttttccttctacaaaaattata |
106 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3786 |
gagtaagaagaaaaatggtaatggatttcaaggtcttggtggatgttctaagtgcttgaatagtctctatttggtgagttttccttctacaaaaattata |
3885 |
T |
 |
| Q |
107 |
attttttcttctatctatgatatgttttgatgttctttgtttggtattttgtgacattgaatttgatggatcttgttgaaaattgatgaagattg |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3886 |
attttttcttctatctatgatatgttttgatgttctttgtttggtattttgtgacattgaatttgatggatcttgttgaaaattgatgaagattg |
3980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University