View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20610_low_14 (Length: 256)

Name: NF20610_low_14
Description: NF20610
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20610_low_14
NF20610_low_14
[»] chr7 (2 HSPs)
chr7 (138-232)||(21481378-21481472)
chr7 (19-71)||(21481246-21481298)


Alignment Details
Target: chr7 (Bit Score: 95; Significance: 1e-46; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 138 - 232
Target Start/End: Original strand, 21481378 - 21481472
Alignment:
138 ctctttggtgaagatggcgtgccattattatccactgcagttccagctaaatttgcagcattattcccatgctggtttttctgtgattttcctgc 232  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
21481378 ctctttggtgaagatggcgtgccattattatccactgcagttccagctaaatttgcagcattattcccatgctggtttttctgtgattttcctgc 21481472  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 19 - 71
Target Start/End: Original strand, 21481246 - 21481298
Alignment:
19 cttataagccttgcatgttcagctcaaagtctcttttattgactctactctac 71  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||    
21481246 cttataagctttgcatgttcagctcaaagtctcttttattgactctactctac 21481298  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University