View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20610_low_14 (Length: 256)
Name: NF20610_low_14
Description: NF20610
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20610_low_14 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 95; Significance: 1e-46; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 138 - 232
Target Start/End: Original strand, 21481378 - 21481472
Alignment:
| Q |
138 |
ctctttggtgaagatggcgtgccattattatccactgcagttccagctaaatttgcagcattattcccatgctggtttttctgtgattttcctgc |
232 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21481378 |
ctctttggtgaagatggcgtgccattattatccactgcagttccagctaaatttgcagcattattcccatgctggtttttctgtgattttcctgc |
21481472 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 19 - 71
Target Start/End: Original strand, 21481246 - 21481298
Alignment:
| Q |
19 |
cttataagccttgcatgttcagctcaaagtctcttttattgactctactctac |
71 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21481246 |
cttataagctttgcatgttcagctcaaagtctcttttattgactctactctac |
21481298 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University