View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20610_low_17 (Length: 248)
Name: NF20610_low_17
Description: NF20610
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20610_low_17 |
 |  |
|
| [»] scaffold0306 (1 HSPs) |
 |  |  |
|
| [»] scaffold0152 (1 HSPs) |
 |  |  |
|
| [»] scaffold0302 (1 HSPs) |
 |  |  |
|
| [»] scaffold0025 (1 HSPs) |
 |  |  |
|
| [»] scaffold1248 (1 HSPs) |
 |  |  |
|
| [»] scaffold0952 (1 HSPs) |
 |  |  |
|
| [»] scaffold0140 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr8 (Bit Score: 60; Significance: 1e-25; HSPs: 12)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 167 - 230
Target Start/End: Complemental strand, 8041753 - 8041690
Alignment:
| Q |
167 |
attcggaaatcctctgtttgagaatgaacgaatctgacacataaattctacgatgagaagttct |
230 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
8041753 |
attcggaaatcctctgtttgagaatgaacgaatctcacacataaattctacgatgagaagttct |
8041690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 1 - 43
Target Start/End: Complemental strand, 36470176 - 36470134
Alignment:
| Q |
1 |
ttctcacaatagttatccttttatatgttttagttttagtccc |
43 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
36470176 |
ttctcacaatagttatccttttacatgttttagttttagtccc |
36470134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 42
Target Start/End: Complemental strand, 4623891 - 4623850
Alignment:
| Q |
1 |
ttctcacaatagttatccttttatatgttttagttttagtcc |
42 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
4623891 |
ttctcacaatagttatccttttacatgttttagttttagtcc |
4623850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 1 - 41
Target Start/End: Complemental strand, 30204689 - 30204649
Alignment:
| Q |
1 |
ttctcacaatagttatccttttatatgttttagttttagtc |
41 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
30204689 |
ttctcacaatagttatccttttacatgttttagttttagtc |
30204649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 1 - 43
Target Start/End: Original strand, 39436889 - 39436931
Alignment:
| Q |
1 |
ttctcacaatagttatccttttatatgttttagttttagtccc |
43 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
39436889 |
ttctcacaatagttatttttttatatgttttagttttagtccc |
39436931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 42
Target Start/End: Original strand, 16656026 - 16656067
Alignment:
| Q |
1 |
ttctcacaatagttatccttttatatgttttagttttagtcc |
42 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
16656026 |
ttctcacaatagttatcattttacatgttttagttttagtcc |
16656067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 37
Target Start/End: Original strand, 23403646 - 23403682
Alignment:
| Q |
1 |
ttctcacaatagttatccttttatatgttttagtttt |
37 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
23403646 |
ttctcacaatagttatccttttacatgttttagtttt |
23403682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 4 - 43
Target Start/End: Complemental strand, 36046567 - 36046528
Alignment:
| Q |
4 |
tcacaatagttatccttttatatgttttagttttagtccc |
43 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |||| |
|
|
| T |
36046567 |
tcacaatagttatccttttacatgttttagttttaatccc |
36046528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 43
Target Start/End: Original strand, 21567755 - 21567797
Alignment:
| Q |
1 |
ttctcacaatagttatccttttatatgttttagttttagtccc |
43 |
Q |
| |
|
|||| |||||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
21567755 |
ttcttacaatagttatctttttacatgttttagttttagtccc |
21567797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 42
Target Start/End: Original strand, 37630050 - 37630091
Alignment:
| Q |
1 |
ttctcacaatagttatccttttatatgttttagttttagtcc |
42 |
Q |
| |
|
||||| ||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
37630050 |
ttctcgcaatagttagccttttacatgttttagttttagtcc |
37630091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 6 - 38
Target Start/End: Complemental strand, 29958550 - 29958518
Alignment:
| Q |
6 |
acaatagttatccttttatatgttttagtttta |
38 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
29958550 |
acaatagttatccttttacatgttttagtttta |
29958518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 41
Target Start/End: Original strand, 41787544 - 41787584
Alignment:
| Q |
1 |
ttctcacaatagttatccttttatatgttttagttttagtc |
41 |
Q |
| |
|
|||| |||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
41787544 |
ttcttacaatagttatctttttacatgttttagttttagtc |
41787584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 44; Significance: 4e-16; HSPs: 9)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 171 - 230
Target Start/End: Original strand, 42527332 - 42527391
Alignment:
| Q |
171 |
ggaaatcctctgtttgagaatgaacgaatctgacacataaattctacgatgagaagttct |
230 |
Q |
| |
|
|||||||| |||||||||||||||| ||||| |||||||||||||| ||||||||||||| |
|
|
| T |
42527332 |
ggaaatccactgtttgagaatgaacaaatctcacacataaattctatgatgagaagttct |
42527391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 43
Target Start/End: Original strand, 18808826 - 18808868
Alignment:
| Q |
1 |
ttctcacaatagttatccttttatatgttttagttttagtccc |
43 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18808826 |
ttctcacaatagttatccttttatatgttttagttttagtccc |
18808868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 1 - 43
Target Start/End: Complemental strand, 7409864 - 7409822
Alignment:
| Q |
1 |
ttctcacaatagttatccttttatatgttttagttttagtccc |
43 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||||| |
|
|
| T |
7409864 |
ttctcataatagttatccttttacatgttttagttttagtccc |
7409822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 37
Target Start/End: Original strand, 794961 - 794997
Alignment:
| Q |
1 |
ttctcacaatagttatccttttatatgttttagtttt |
37 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
794961 |
ttctcacaatagttatccttttacatgttttagtttt |
794997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 7 - 43
Target Start/End: Original strand, 39002001 - 39002037
Alignment:
| Q |
7 |
caatagttatccttttatatgttttagttttagtccc |
43 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
39002001 |
caatagttatccttttacatgttttagttttagtccc |
39002037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 40
Target Start/End: Complemental strand, 41998920 - 41998881
Alignment:
| Q |
1 |
ttctcacaatagttatccttttatatgttttagttttagt |
40 |
Q |
| |
|
||||||||||| ||||| |||||||||||||||||||||| |
|
|
| T |
41998920 |
ttctcacaatatttatctttttatatgttttagttttagt |
41998881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 4 - 42
Target Start/End: Complemental strand, 6750348 - 6750310
Alignment:
| Q |
4 |
tcacaatagttatccttttatatgttttagttttagtcc |
42 |
Q |
| |
|
|||||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
6750348 |
tcacaatagttatctttttacatgttttagttttagtcc |
6750310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 5 - 43
Target Start/End: Original strand, 11121909 - 11121947
Alignment:
| Q |
5 |
cacaatagttatccttttatatgttttagttttagtccc |
43 |
Q |
| |
|
||||||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
11121909 |
cacaatagttatcattttacatgttttagttttagtccc |
11121947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 43
Target Start/End: Original strand, 36290639 - 36290681
Alignment:
| Q |
1 |
ttctcacaatagttatccttttatatgttttagttttagtccc |
43 |
Q |
| |
|
|||| |||||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
36290639 |
ttctgacaatagttatcattttacatgttttagttttagtccc |
36290681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 14)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 43
Target Start/End: Original strand, 27004497 - 27004539
Alignment:
| Q |
1 |
ttctcacaatagttatccttttatatgttttagttttagtccc |
43 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27004497 |
ttctcacaatagttatccttttatatgttttagttttagtccc |
27004539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 1 - 43
Target Start/End: Complemental strand, 15070431 - 15070389
Alignment:
| Q |
1 |
ttctcacaatagttatccttttatatgttttagttttagtccc |
43 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
15070431 |
ttctcacaatagttatccttttatatgtttttgttttagtccc |
15070389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 1 - 43
Target Start/End: Complemental strand, 30757225 - 30757183
Alignment:
| Q |
1 |
ttctcacaatagttatccttttatatgttttagttttagtccc |
43 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
30757225 |
ttctcacaatagttatccttttacatgttttagttttagtccc |
30757183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 4 - 41
Target Start/End: Complemental strand, 5807358 - 5807321
Alignment:
| Q |
4 |
tcacaatagttatccttttatatgttttagttttagtc |
41 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5807358 |
tcacaatagttatccttttatatgttttagttttagtc |
5807321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 40
Target Start/End: Original strand, 27969535 - 27969574
Alignment:
| Q |
1 |
ttctcacaatagttatccttttatatgttttagttttagt |
40 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
27969535 |
ttctcacaatagttatccttttatatgttttaattttagt |
27969574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 40
Target Start/End: Complemental strand, 37060120 - 37060081
Alignment:
| Q |
1 |
ttctcacaatagttatccttttatatgttttagttttagt |
40 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
37060120 |
ttctcacaatagttatccttttacatgttttagttttagt |
37060081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 1 - 43
Target Start/End: Original strand, 4382255 - 4382297
Alignment:
| Q |
1 |
ttctcacaatagttatccttttatatgttttagttttagtccc |
43 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
4382255 |
ttctcacaatagttatcattttacatgttttagttttagtccc |
4382297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 1 - 43
Target Start/End: Original strand, 14786282 - 14786324
Alignment:
| Q |
1 |
ttctcacaatagttatccttttatatgttttagttttagtccc |
43 |
Q |
| |
|
||||||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
14786282 |
ttctcacaatagttatcctattacatgttttagttttagtccc |
14786324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 1 - 43
Target Start/End: Complemental strand, 28107529 - 28107487
Alignment:
| Q |
1 |
ttctcacaatagttatccttttatatgttttagttttagtccc |
43 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||| |||| |
|
|
| T |
28107529 |
ttctcacaatagttatccttttacatgttttagttttaatccc |
28107487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 42
Target Start/End: Complemental strand, 6974558 - 6974517
Alignment:
| Q |
1 |
ttctcacaatagttatccttttatatgttttagttttagtcc |
42 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
6974558 |
ttctcacaatagttatcattttacatgttttagttttagtcc |
6974517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 2 - 43
Target Start/End: Original strand, 21423414 - 21423455
Alignment:
| Q |
2 |
tctcacaatagttatccttttatatgttttagttttagtccc |
43 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
21423414 |
tctcacaatagttatcctattacatgttttagttttagtccc |
21423455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 42
Target Start/End: Complemental strand, 30609727 - 30609686
Alignment:
| Q |
1 |
ttctcacaatagttatccttttatatgttttagttttagtcc |
42 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
30609727 |
ttctcacaatagttatcattttacatgttttagttttagtcc |
30609686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 8 - 43
Target Start/End: Original strand, 5959021 - 5959056
Alignment:
| Q |
8 |
aatagttatccttttatatgttttagttttagtccc |
43 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
5959021 |
aatagttatccttttacatgttttagttttagtccc |
5959056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 42
Target Start/End: Original strand, 13274249 - 13274289
Alignment:
| Q |
1 |
ttctcacaatagttatccttttatatgttttagttttagtcc |
42 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
13274249 |
ttctcacaatagttatc-ttttacatgttttagttttagtcc |
13274289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0306 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: scaffold0306
Description:
Target: scaffold0306; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 1 - 43
Target Start/End: Complemental strand, 13097 - 13055
Alignment:
| Q |
1 |
ttctcacaatagttatccttttatatgttttagttttagtccc |
43 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
13097 |
ttctcacaatagttatccttttacatgttttagttttagtccc |
13055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0152 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: scaffold0152
Description:
Target: scaffold0152; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 1 - 43
Target Start/End: Original strand, 22230 - 22272
Alignment:
| Q |
1 |
ttctcacaatagttatccttttatatgttttagttttagtccc |
43 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
22230 |
ttctcacaatagttatccttttacatgttttagttttagtccc |
22272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 5)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 1 - 43
Target Start/End: Original strand, 41326089 - 41326131
Alignment:
| Q |
1 |
ttctcacaatagttatccttttatatgttttagttttagtccc |
43 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
41326089 |
ttctcacaatagttatccttttacatgttttagttttagtccc |
41326131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 1 - 41
Target Start/End: Original strand, 31637762 - 31637802
Alignment:
| Q |
1 |
ttctcacaatagttatccttttatatgttttagttttagtc |
41 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
31637762 |
ttctcataatagttatccttttatatgttttagttttagtc |
31637802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 1 - 43
Target Start/End: Complemental strand, 40337107 - 40337065
Alignment:
| Q |
1 |
ttctcacaatagttatccttttatatgttttagttttagtccc |
43 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
40337107 |
ttctcacaatagttatcattttacatgttttagttttagtccc |
40337065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 41
Target Start/End: Complemental strand, 8163684 - 8163644
Alignment:
| Q |
1 |
ttctcacaatagttatccttttatatgttttagttttagtc |
41 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
8163684 |
ttctcacaatagttatctttttacatgttttagttttagtc |
8163644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 43
Target Start/End: Original strand, 28089182 - 28089224
Alignment:
| Q |
1 |
ttctcacaatagttatccttttatatgttttagttttagtccc |
43 |
Q |
| |
|
|||| |||||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
28089182 |
ttcttacaatagttatcattttacatgttttagttttagtccc |
28089224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 9)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 1 - 43
Target Start/End: Complemental strand, 4032368 - 4032326
Alignment:
| Q |
1 |
ttctcacaatagttatccttttatatgttttagttttagtccc |
43 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
4032368 |
ttctcacaatagttatctttttatatgttttagttttagtccc |
4032326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 1 - 43
Target Start/End: Original strand, 444569 - 444611
Alignment:
| Q |
1 |
ttctcacaatagttatccttttatatgttttagttttagtccc |
43 |
Q |
| |
|
||||||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
444569 |
ttctcacaatagttatcctattacatgttttagttttagtccc |
444611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 1 - 43
Target Start/End: Complemental strand, 2814931 - 2814889
Alignment:
| Q |
1 |
ttctcacaatagttatccttttatatgttttagttttagtccc |
43 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
2814931 |
ttctcacaatagttatcattttacatgttttagttttagtccc |
2814889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 1 - 43
Target Start/End: Original strand, 23774117 - 23774159
Alignment:
| Q |
1 |
ttctcacaatagttatccttttatatgttttagttttagtccc |
43 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||| |||| |
|
|
| T |
23774117 |
ttctcataatagttatccttttatatgttttagttttaatccc |
23774159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 1 - 43
Target Start/End: Complemental strand, 24640393 - 24640351
Alignment:
| Q |
1 |
ttctcacaatagttatccttttatatgttttagttttagtccc |
43 |
Q |
| |
|
|||||| ||||||||||||| |||||||||||||||||||||| |
|
|
| T |
24640393 |
ttctcataatagttatccttctatatgttttagttttagtccc |
24640351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 41
Target Start/End: Complemental strand, 6200203 - 6200163
Alignment:
| Q |
1 |
ttctcacaatagttatccttttatatgttttagttttagtc |
41 |
Q |
| |
|
||||||||||||||||||||||| || |||||||||||||| |
|
|
| T |
6200203 |
ttctcacaatagttatccttttacatattttagttttagtc |
6200163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 41
Target Start/End: Original strand, 34710159 - 34710199
Alignment:
| Q |
1 |
ttctcacaatagttatccttttatatgttttagttttagtc |
41 |
Q |
| |
|
|||||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
34710159 |
ttctcacagtagttattcttttatatgttttagttttagtc |
34710199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 43
Target Start/End: Original strand, 1067848 - 1067891
Alignment:
| Q |
1 |
ttctcacaatagttatcctttt-atatgttttagttttagtccc |
43 |
Q |
| |
|
||||||||||||||| |||||| ||||||||||||||||||||| |
|
|
| T |
1067848 |
ttctcacaatagttaccctttttatatgttttagttttagtccc |
1067891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 34
Target Start/End: Complemental strand, 2993625 - 2993592
Alignment:
| Q |
1 |
ttctcacaatagttatccttttatatgttttagt |
34 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| |
|
|
| T |
2993625 |
ttctcacaatagttatccttttatatcttttagt |
2993592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 12)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 1 - 43
Target Start/End: Complemental strand, 38451080 - 38451038
Alignment:
| Q |
1 |
ttctcacaatagttatccttttatatgttttagttttagtccc |
43 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
38451080 |
ttctcacaatagttatccttttacatgttttagttttagtccc |
38451038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 1 - 43
Target Start/End: Complemental strand, 39508357 - 39508315
Alignment:
| Q |
1 |
ttctcacaatagttatccttttatatgttttagttttagtccc |
43 |
Q |
| |
|
|||||||||||||||| |||||| ||||||||||||||||||| |
|
|
| T |
39508357 |
ttctcacaatagttattcttttacatgttttagttttagtccc |
39508315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 42
Target Start/End: Complemental strand, 3729374 - 3729333
Alignment:
| Q |
1 |
ttctcacaatagttatccttttatatgttttagttttagtcc |
42 |
Q |
| |
|
||||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
3729374 |
ttctcacaataattatccttttacatgttttagttttagtcc |
3729333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 42
Target Start/End: Complemental strand, 8159111 - 8159070
Alignment:
| Q |
1 |
ttctcacaatagttatccttttatatgttttagttttagtcc |
42 |
Q |
| |
|
||||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
8159111 |
ttctcacaataattatccttttacatgttttagttttagtcc |
8159070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 6 - 43
Target Start/End: Complemental strand, 9793671 - 9793634
Alignment:
| Q |
6 |
acaatagttatccttttatatgttttagttttagtccc |
43 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
9793671 |
acaatagttatccttttacatgttttagttttagtccc |
9793634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 42
Target Start/End: Original strand, 21020731 - 21020772
Alignment:
| Q |
1 |
ttctcacaatagttatccttttatatgttttagttttagtcc |
42 |
Q |
| |
|
||||| ||||||||||||||||||||| |||||||||||||| |
|
|
| T |
21020731 |
ttctcgcaatagttatccttttatatgatttagttttagtcc |
21020772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 41
Target Start/End: Complemental strand, 34766925 - 34766885
Alignment:
| Q |
1 |
ttctcacaatagttatccttttatatgttttagttttagtc |
41 |
Q |
| |
|
|||||||||||||||| |||||| ||||||||||||||||| |
|
|
| T |
34766925 |
ttctcacaatagttattcttttacatgttttagttttagtc |
34766885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 4 - 43
Target Start/End: Complemental strand, 20736196 - 20736157
Alignment:
| Q |
4 |
tcacaatagttatccttttatatgttttagttttagtccc |
43 |
Q |
| |
|
|||||||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
20736196 |
tcacaatagttatcattttacatgttttagttttagtccc |
20736157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 7 - 42
Target Start/End: Original strand, 41929395 - 41929430
Alignment:
| Q |
7 |
caatagttatccttttatatgttttagttttagtcc |
42 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| |
|
|
| T |
41929395 |
caatagttatccttttacatgttttagttttagtcc |
41929430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 6 - 43
Target Start/End: Complemental strand, 9793768 - 9793731
Alignment:
| Q |
6 |
acaatagttatccttttatatgttttagttttagtccc |
43 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| |
|
|
| T |
9793768 |
acaatagttatccttttacttgttttagttttagtccc |
9793731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 42
Target Start/End: Original strand, 21583897 - 21583938
Alignment:
| Q |
1 |
ttctcacaatagttatccttttatatgttttagttttagtcc |
42 |
Q |
| |
|
|||||| |||||||||| ||||| |||||||||||||||||| |
|
|
| T |
21583897 |
ttctcataatagttatctttttacatgttttagttttagtcc |
21583938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 4 - 41
Target Start/End: Complemental strand, 41910256 - 41910219
Alignment:
| Q |
4 |
tcacaatagttatccttttatatgttttagttttagtc |
41 |
Q |
| |
|
|||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
41910256 |
tcacaatagttatcattttacatgttttagttttagtc |
41910219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 10)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 1 - 43
Target Start/End: Original strand, 21555428 - 21555470
Alignment:
| Q |
1 |
ttctcacaatagttatccttttatatgttttagttttagtccc |
43 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
21555428 |
ttctcacaatagttatccttttacatgttttagttttagtccc |
21555470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 1 - 43
Target Start/End: Original strand, 23249518 - 23249560
Alignment:
| Q |
1 |
ttctcacaatagttatccttttatatgttttagttttagtccc |
43 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
23249518 |
ttctcacaatagttatccttttacatgttttagttttagtccc |
23249560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 1 - 43
Target Start/End: Original strand, 35929755 - 35929797
Alignment:
| Q |
1 |
ttctcacaatagttatccttttatatgttttagttttagtccc |
43 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
35929755 |
ttctcacaatagttatcattttatatgttttagttttagtccc |
35929797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 1 - 43
Target Start/End: Complemental strand, 36609454 - 36609412
Alignment:
| Q |
1 |
ttctcacaatagttatccttttatatgttttagttttagtccc |
43 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
36609454 |
ttctcacaatagttatccttttacatgttttagttttagtccc |
36609412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 42
Target Start/End: Original strand, 27733424 - 27733465
Alignment:
| Q |
1 |
ttctcacaatagttatccttttatatgttttagttttagtcc |
42 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
27733424 |
ttctcacaatagttatccttttacatgttttagttttagtcc |
27733465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 42
Target Start/End: Complemental strand, 44243737 - 44243696
Alignment:
| Q |
1 |
ttctcacaatagttatccttttatatgttttagttttagtcc |
42 |
Q |
| |
|
|||| ||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
44243737 |
ttcttacaatagttatccttttatatgttttaattttagtcc |
44243696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 2 - 43
Target Start/End: Complemental strand, 53583511 - 53583470
Alignment:
| Q |
2 |
tctcacaatagttatccttttatatgttttagttttagtccc |
43 |
Q |
| |
|
|||||||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
53583511 |
tctcacaatagtaatccttttacatgttttagttttagtccc |
53583470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 41
Target Start/End: Original strand, 827877 - 827917
Alignment:
| Q |
1 |
ttctcacaatagttatccttttatatgttttagttttagtc |
41 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
827877 |
ttctcacaatagttatctttttacatgttttagttttagtc |
827917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 42
Target Start/End: Original strand, 12701086 - 12701127
Alignment:
| Q |
1 |
ttctcacaatagttatccttttatatgttttagttttagtcc |
42 |
Q |
| |
|
|||| ||||||||||| |||||| |||||||||||||||||| |
|
|
| T |
12701086 |
ttcttacaatagttattcttttacatgttttagttttagtcc |
12701127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 41
Target Start/End: Original strand, 35749433 - 35749473
Alignment:
| Q |
1 |
ttctcacaatagttatccttttatatgttttagttttagtc |
41 |
Q |
| |
|
|||||| |||| ||||| ||||||||||||||||||||||| |
|
|
| T |
35749433 |
ttctcataataattatctttttatatgttttagttttagtc |
35749473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 11)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 1 - 43
Target Start/End: Complemental strand, 36404263 - 36404221
Alignment:
| Q |
1 |
ttctcacaatagttatccttttatatgttttagttttagtccc |
43 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
36404263 |
ttctcacaatagttatccttttacatgttttagttttagtccc |
36404221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 1 - 43
Target Start/End: Original strand, 46487317 - 46487359
Alignment:
| Q |
1 |
ttctcacaatagttatccttttatatgttttagttttagtccc |
43 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
46487317 |
ttctcacaatagttatcattttatatgttttagttttagtccc |
46487359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 1 - 41
Target Start/End: Original strand, 47599412 - 47599452
Alignment:
| Q |
1 |
ttctcacaatagttatccttttatatgttttagttttagtc |
41 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
47599412 |
ttctcacaatagttatccttttacatgttttagttttagtc |
47599452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 40
Target Start/End: Original strand, 35534530 - 35534569
Alignment:
| Q |
1 |
ttctcacaatagttatccttttatatgttttagttttagt |
40 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
35534530 |
ttctcacaatagttatcattttatatgttttagttttagt |
35534569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 4 - 43
Target Start/End: Original strand, 39392008 - 39392047
Alignment:
| Q |
4 |
tcacaatagttatccttttatatgttttagttttagtccc |
43 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
39392008 |
tcacaatagttatccttttacatgttttagttttagtccc |
39392047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 1 - 43
Target Start/End: Original strand, 29360530 - 29360572
Alignment:
| Q |
1 |
ttctcacaatagttatccttttatatgttttagttttagtccc |
43 |
Q |
| |
|
|||||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
29360530 |
ttctcacagtagttatccttttacatgttttagttttagtccc |
29360572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 4 - 42
Target Start/End: Original strand, 45603035 - 45603073
Alignment:
| Q |
4 |
tcacaatagttatccttttatatgttttagttttagtcc |
42 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
45603035 |
tcacaatagttatccttttacatgttttagttttagtcc |
45603073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 42
Target Start/End: Complemental strand, 37115928 - 37115887
Alignment:
| Q |
1 |
ttctcacaatagttatccttttatatgttttagttttagtcc |
42 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||||||| |
|
|
| T |
37115928 |
ttctcgcaatagttatcattttatatgttttagttttagtcc |
37115887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 43
Target Start/End: Complemental strand, 3618381 - 3618339
Alignment:
| Q |
1 |
ttctcacaatagttatccttttatatgttttagttttagtccc |
43 |
Q |
| |
|
||||||||||| ||||| ||||| ||||||||||||||||||| |
|
|
| T |
3618381 |
ttctcacaatatttatctttttacatgttttagttttagtccc |
3618339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 43
Target Start/End: Complemental strand, 54883033 - 54882991
Alignment:
| Q |
1 |
ttctcacaatagttatccttttatatgttttagttttagtccc |
43 |
Q |
| |
|
||||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
54883033 |
ttctcacaatatttatccttttacgtgttttagttttagtccc |
54882991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 4 - 37
Target Start/End: Complemental strand, 16353527 - 16353494
Alignment:
| Q |
4 |
tcacaatagttatccttttatatgttttagtttt |
37 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| |
|
|
| T |
16353527 |
tcacaatagttatccttttacatgttttagtttt |
16353494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0302 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: scaffold0302
Description:
Target: scaffold0302; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 42
Target Start/End: Complemental strand, 18544 - 18503
Alignment:
| Q |
1 |
ttctcacaatagttatccttttatatgttttagttttagtcc |
42 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
18544 |
ttctcacaatagttatccttttacatgttttagttttagtcc |
18503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0025 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: scaffold0025
Description:
Target: scaffold0025; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 40
Target Start/End: Original strand, 67920 - 67959
Alignment:
| Q |
1 |
ttctcacaatagttatccttttatatgttttagttttagt |
40 |
Q |
| |
|
|||| |||||||||||||||||| |||||||||||||||| |
|
|
| T |
67920 |
ttctaacaatagttatccttttacatgttttagttttagt |
67959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1248 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold1248
Description:
Target: scaffold1248; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 8 - 42
Target Start/End: Original strand, 1023 - 1057
Alignment:
| Q |
8 |
aatagttatccttttatatgttttagttttagtcc |
42 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| |
|
|
| T |
1023 |
aatagttattcttttatatgttttagttttagtcc |
1057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0952 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0952
Description:
Target: scaffold0952; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 8 - 42
Target Start/End: Complemental strand, 1290 - 1256
Alignment:
| Q |
8 |
aatagttatccttttatatgttttagttttagtcc |
42 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| |
|
|
| T |
1290 |
aatagttattcttttatatgttttagttttagtcc |
1256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0140 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0140
Description:
Target: scaffold0140; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 43
Target Start/End: Original strand, 21524 - 21566
Alignment:
| Q |
1 |
ttctcacaatagttatccttttatatgttttagttttagtccc |
43 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
21524 |
ttctcacaatagttattattttacatgttttagttttagtccc |
21566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University