View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20611_low_19 (Length: 250)

Name: NF20611_low_19
Description: NF20611
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20611_low_19
NF20611_low_19
[»] chr5 (1 HSPs)
chr5 (11-250)||(2590345-2590590)


Alignment Details
Target: chr5 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 11 - 250
Target Start/End: Original strand, 2590345 - 2590590
Alignment:
11 agaaaattgctagaataaagttgatggaacgtcactttagggttagatggagatatgggtcctacatgcaggttgtaaatgtcgacttcagttccctcag 110  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2590345 agaaaattgctagaataaagttgatggaacgtcactttagggttagatggagatatgggtcctacatgcaggttgtaaatgtcgacttcagttccctcag 2590444  T
111 ttttaaaagaaggaaagatagaaagagaaagagataactattgca------ttgcacttgcacttgcacacatacactgatatatgaatgaaggtacaat 204  Q
    |||||||||||||||||||||||||||||||||||||||||||||      |||||||||||||||||||||||||||||||||||||||||||||||||    
2590445 ttttaaaagaaggaaagatagaaagagaaagagataactattgcattgcacttgcacttgcacttgcacacatacactgatatatgaatgaaggtacaat 2590544  T
205 ttactaaacaaaaagagacaggaatagaacaagagaaagatgggtc 250  Q
    |||||||||||||||||||||| |||||||||||||||||||||||    
2590545 ttactaaacaaaaagagacaggcatagaacaagagaaagatgggtc 2590590  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University