View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20612_high_12 (Length: 238)
Name: NF20612_high_12
Description: NF20612
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20612_high_12 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 156; Significance: 5e-83; HSPs: 4)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 1 - 164
Target Start/End: Original strand, 4078113 - 4078276
Alignment:
| Q |
1 |
cacaagtgagggtggaacataacaagggtgagattgattggataatagatgaaatttatgccttgttcgactgcaaaaaactagggaggatatggacttt |
100 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
4078113 |
cacaagtgagggtggcacataacaagggtgagattgattggataatagatgaaatttatgccttgttcgactccaaaaaactagggaggatatggacttt |
4078212 |
T |
|
| Q |
101 |
gcatcatttgtatctcaagttcttggaattcctcccaaactgagggaatgtgaaggatggtgtg |
164 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4078213 |
gcatcatttgtatctcaagttcttggaattcctcccaaactgagggaatgtgaaggatggtgtg |
4078276 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 1 - 164
Target Start/End: Original strand, 4100868 - 4101031
Alignment:
| Q |
1 |
cacaagtgagggtggaacataacaagggtgagattgattggataatagatgaaatttatgccttgttcgactgcaaaaaactagggaggatatggacttt |
100 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
4100868 |
cacaagtgagggtggcacataacaagggtgagattgattggataatagatgaaatttatgccttgttcaactgcaaaaaactagggaggatatggacttt |
4100967 |
T |
|
| Q |
101 |
gcatcatttgtatctcaagttcttggaattcctcccaaactgagggaatgtgaaggatggtgtg |
164 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
4100968 |
gcatcatttgtatctcaagttcttggaattcctcctaaactgagggaatgtgaaggatggtgtg |
4101031 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 165 - 220
Target Start/End: Original strand, 4078375 - 4078430
Alignment:
| Q |
165 |
caatgaaattgaagttgaaaaactaagttttctctgttaaatttgctaggcaatga |
220 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
4078375 |
caatgaaattgaagttgaaaaactatgttttctctgttaaatttgctaggcaatga |
4078430 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 165 - 220
Target Start/End: Original strand, 4101128 - 4101183
Alignment:
| Q |
165 |
caatgaaattgaagttgaaaaactaagttttctctgttaaatttgctaggcaatga |
220 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
4101128 |
caatgaaattgaagttgaaaaactatgttttctctgttaaatttgctaggcaatga |
4101183 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 82 - 139
Target Start/End: Complemental strand, 4502677 - 4502620
Alignment:
| Q |
82 |
tagggaggatatggactttgcatcatttgtatctcaagttcttggaattcctcccaaa |
139 |
Q |
| |
|
||||||||||||||||| |||||| ||||| || |||||| |||||||||||||||| |
|
|
| T |
4502677 |
tagggaggatatggactccgcatcagttgtacctaaagttcatggaattcctcccaaa |
4502620 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 89 - 148
Target Start/End: Original strand, 19568715 - 19568774
Alignment:
| Q |
89 |
gatatggactttgcatcatttgtatctcaagttcttggaattcctcccaaactgagggaa |
148 |
Q |
| |
|
|||||||||| || ||||| |||||||||||||| ||||||||||| |||| ||| |||| |
|
|
| T |
19568715 |
gatatggactatgtatcatctgtatctcaagttcatggaattcctctcaaagtgaaggaa |
19568774 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University