View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20612_low_13 (Length: 236)

Name: NF20612_low_13
Description: NF20612
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20612_low_13
NF20612_low_13
[»] chr4 (1 HSPs)
chr4 (18-148)||(45695603-45695733)


Alignment Details
Target: chr4 (Bit Score: 119; Significance: 6e-61; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 18 - 148
Target Start/End: Original strand, 45695603 - 45695733
Alignment:
18 atatgatggttgatgactcactacctgcattgtaattgtgtaattatgtaacatgtctgactcaatttcattgttgctggaccggccatactaaatggtc 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
45695603 atatgatggttgatgactcactacctgcattgtaattgtgtaattatgtaacatgtctgactcaattacattgttgctggaccggccatactaaatggtc 45695702  T
118 tcgctataaatacaagtctgtctatatatat 148  Q
    ||||||||||||||||||| | |||||||||    
45695703 tcgctataaatacaagtctatatatatatat 45695733  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University