View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20612_low_14 (Length: 236)
Name: NF20612_low_14
Description: NF20612
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20612_low_14 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 5443531 - 5443748
Alignment:
| Q |
1 |
ataccgtcgtttagtgaagattaatctctatgataaaatcgataaacacgaattctctcttcttaactaattttctttaaaacgtgtatcaaacctttaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
5443531 |
ataccgtcgtttagtgaagattaatctctataataaaatcaataaacacgaattctctcttcttaactaattttctttaaaacgtgtatcaaaccgttaa |
5443630 |
T |
|
| Q |
101 |
ccatttgcttaagtattcgaaatccccgacactcaaagcaacatgtataatgtattgttgtagcttggtttaaattacacaattgatgtaattggatata |
200 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| | |
|
|
| T |
5443631 |
ccatttgcttaagtgttcgaaatccccgacactcaaagcaacatgtataatgtattgttgtagcttggtttaaattacacatttgatgtaattgg----a |
5443726 |
T |
|
| Q |
201 |
ttggataagaattgcaattggt |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
5443727 |
ttggataagaattgcaattggt |
5443748 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University