View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20613_high_12 (Length: 237)
Name: NF20613_high_12
Description: NF20613
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20613_high_12 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 19 - 222
Target Start/End: Complemental strand, 25884823 - 25884620
Alignment:
| Q |
19 |
aaggaaatggatgagaatgcagtgcaacgagaggagaattgtgatggtgatgtagctgtggagataaaagatgggaaattctcatgggatgataacgatg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25884823 |
aaggaaatggatgagaatgcagtgcaacgagaggagaattgtgatggtgatgtagctgtggagataaaagatgggaaattctcatgggatgataacgatg |
25884724 |
T |
|
| Q |
119 |
agaacgacgctctgagagttgaagagttggtaattaagaaaggggatcatgctgctgttgtaggaactgttggttcagggaagtcttcattattggcttc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25884723 |
agaacgacgctctgagagttgaagagttggtaattaagaaaggggatcatgctgctgttgtaggaactgttggttcagggaagtcttcattattggcttc |
25884624 |
T |
|
| Q |
219 |
tgtg |
222 |
Q |
| |
|
|||| |
|
|
| T |
25884623 |
tgtg |
25884620 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 148; Significance: 3e-78; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 19 - 222
Target Start/End: Complemental strand, 14320141 - 14319938
Alignment:
| Q |
19 |
aaggaaatggatgagaatgcagtgcaacgagaggagaattgtgatggtgatgtagctgtggagataaaagatgggaaattctcatgggatgataacgatg |
118 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |||| |
|
|
| T |
14320141 |
aaggaaatggatgagaatgcagtgcaaagagaggagaattgtgatggtgatgtagccgtggagataaaagatgggaaattttcatgggatgataaggatg |
14320042 |
T |
|
| Q |
119 |
agaacgacgctctgagagttgaagagttggtaattaagaaaggggatcatgctgctgttgtaggaactgttggttcagggaagtcttcattattggcttc |
218 |
Q |
| |
|
|||| || || ||| ||| |||||||||||||||||||||||||| | ||||||| |||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
14320041 |
agaatgaggcgttgacagtggaagagttggtaattaagaaaggggaccgtgctgctattgtaggaactgttggttcaggcaagtcttcattattggcttc |
14319942 |
T |
|
| Q |
219 |
tgtg |
222 |
Q |
| |
|
|||| |
|
|
| T |
14319941 |
tgtg |
14319938 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 19 - 222
Target Start/End: Complemental strand, 14303750 - 14303547
Alignment:
| Q |
19 |
aaggaaatggatgagaatgcagtgcaacgagaggagaattgtgatggtgatgtagctgtggagataaaagatgggaaattctcatgggatgataacgatg |
118 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||| ||| ||||||||||||||||||||||||||||||||||||| || |||||||||| |||| |
|
|
| T |
14303750 |
aaggaaatggatgagaatgcagtgcaaagagaggagaactgtaatggtgatgtagctgtggagataaaagatgggaaattttcttgggatgatatggatg |
14303651 |
T |
|
| Q |
119 |
agaacgacgctctgagagttgaagagttggtaattaagaaaggggatcatgctgctgttgtaggaactgttggttcagggaagtcttcattattggcttc |
218 |
Q |
| |
|
|||| || ||| || ||||| | || ||||| |||||||||||||| |||||||||||||||||||||||||| ||||| |||||||||||| ||||||| |
|
|
| T |
14303650 |
agaatgaggctttgcgagttaaggaattggtgattaagaaaggggaccatgctgctgttgtaggaactgttggatcaggcaagtcttcattactggcttc |
14303551 |
T |
|
| Q |
219 |
tgtg |
222 |
Q |
| |
|
|||| |
|
|
| T |
14303550 |
tgtg |
14303547 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 19 - 222
Target Start/End: Complemental strand, 14281992 - 14281789
Alignment:
| Q |
19 |
aaggaaatggatgagaatgcagtgcaacgagaggagaattgtgatggtgatgtagctgtggagataaaagatgggaaattctcatgggatgataacgatg |
118 |
Q |
| |
|
|||||||||||||| | ||| |||||| |||| |||| ||||| |||||||||||||||||||||||||||||||||||| || |||||||||||||||| |
|
|
| T |
14281992 |
aaggaaatggatgatagtgctgtgcaaagagatgagagttgtggtggtgatgtagctgtggagataaaagatgggaaattttcttgggatgataacgatg |
14281893 |
T |
|
| Q |
119 |
agaacgacgctctgagagttgaagagttggtaattaagaaaggggatcatgctgctgttgtaggaactgttggttcagggaagtcttcattattggcttc |
218 |
Q |
| |
|
|||| || || ||| |||||||||||||||||||||||||||||| ||||||||| |||||||||| ||||| || || |||||||||||||||||||| |
|
|
| T |
14281892 |
agaatgaggcgttgacagttgaagagttggtaattaagaaaggggaccatgctgctattgtaggaacagttggatcgggcaagtcttcattattggcttc |
14281793 |
T |
|
| Q |
219 |
tgtg |
222 |
Q |
| |
|
|||| |
|
|
| T |
14281792 |
tgtg |
14281789 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University