View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20613_high_13 (Length: 234)
Name: NF20613_high_13
Description: NF20613
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20613_high_13 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 76; Significance: 3e-35; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 137 - 216
Target Start/End: Complemental strand, 9421777 - 9421698
Alignment:
| Q |
137 |
gttgaaatgaaaatgatatcataaccgttatagttatgtaatgtaaacatactttacacatgagattaaaatactctact |
216 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9421777 |
gttgaaatgaaaatgaaatcataaccgttatagttatgtaatgtaaacatactttacacatgagattaaaatactctact |
9421698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 59 - 107
Target Start/End: Complemental strand, 9421855 - 9421807
Alignment:
| Q |
59 |
tgtggtgaggtgagtaagtaagaggttggttgaggggaatatatatagg |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9421855 |
tgtggtgaggtgagtaagtaagaggttggttgaggggaatatatatagg |
9421807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University