View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20613_low_13 (Length: 242)
Name: NF20613_low_13
Description: NF20613
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20613_low_13 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 226
Target Start/End: Original strand, 19641929 - 19642154
Alignment:
| Q |
1 |
ttaataataaaaattaataaggattaactacctaaaaactactgggcaatagtccttccatttgaactcactggacggatgtggaggcgtatatttggat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19641929 |
ttaataataaaaattaataaggattaactacctaaaaactactgggcaatagtccttccatttgaactcactggacggatgtggaggcgtatatttggat |
19642028 |
T |
|
| Q |
101 |
ccttcgggaggaaatctagtccatactttctctttggaatcaaaagctgaaggcttcagatctaaagatgctgagggggcaggtcttccaacagaatgcc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
19642029 |
ccttcgggaggaaatctagtccatactttctctttggaatcaaaagctgaaggcttcagatctaaagatgccgagggggcaggtcttccaacagaatgcc |
19642128 |
T |
|
| Q |
201 |
tattatatgcaacaactcaaacaatt |
226 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
19642129 |
tattatatgcaacaactcaaacaatt |
19642154 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 50; Significance: 9e-20; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 30 - 203
Target Start/End: Complemental strand, 35257821 - 35257648
Alignment:
| Q |
30 |
acctaaaaactactgggcaatagtccttccatttgaactcactggacggatgtggaggcgtatatttggatccttcgggaggaaatctagtccatacttt |
129 |
Q |
| |
|
||||||||||||| ||||||||||| ||||| || || |||| || |||||||| || |||||||| |||||||| || |||||||| ||||| ||||| |
|
|
| T |
35257821 |
acctaaaaactacagggcaatagtctttccacttaaagtcacatgatggatgtggtggagtatattttgatccttcaggtggaaatcttgtccacacttt |
35257722 |
T |
|
| Q |
130 |
ctctttggaatcaaaagctgaaggcttcagatctaaagatgctgagggggcaggtcttccaacagaatgcctat |
203 |
Q |
| |
|
||| || | || |||||||| ||||| ||||| | ||||||| || ||||||||| |||| || ||||||| |
|
|
| T |
35257721 |
ctcctttgggtcgaaagctgatggcttaagatcaagtgatgctgtaggagcaggtcttgcaactgagtgcctat |
35257648 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 86 - 158
Target Start/End: Complemental strand, 4194543 - 4194471
Alignment:
| Q |
86 |
ggcgtatatttggatccttcgggaggaaatctagtccatactttctctttggaatcaaaagctgaaggcttca |
158 |
Q |
| |
|
||||||| ||||||||||| || |||||||||||||| ||||||||||| | |||||| || |||| ||||| |
|
|
| T |
4194543 |
ggcgtatgcttggatccttctggtggaaatctagtccaaactttctcttttggatcaaatgcagaagacttca |
4194471 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University