View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20613_low_7 (Length: 314)
Name: NF20613_low_7
Description: NF20613
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20613_low_7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 112 - 304
Target Start/End: Original strand, 8638199 - 8638391
Alignment:
| Q |
112 |
cccttcctttatatgttgtgcactttgtcaacaagcctttgagtatcttggacttggtggctattgttgtttgtttaagtggcattgttatagcatactt |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8638199 |
cccttcctttatatgttgtgcactttgtcaacaagcctttgagtatcttggacttggtggctattgttgtttgtttaagtggcattgttatagcatactt |
8638298 |
T |
 |
| Q |
212 |
ttctgatacacaactccatgactttatgagtagaaacaaccagctgaaagggcttggtaaacctgtaatccctgtacttgacactggcctatg |
304 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8638299 |
tgctgatacacaactccatgactttatgagtagaaacaaccagctgaaaggccttggtaaacctgtaatccctgtacttgacactggcctatg |
8638391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University