View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20614_low_10 (Length: 281)
Name: NF20614_low_10
Description: NF20614
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20614_low_10 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 33 - 281
Target Start/End: Original strand, 1737760 - 1738004
Alignment:
| Q |
33 |
tagtcatgctatagcactgttgcgtagcggattcggaacaaatcgctatttctttgtgatccgcaatcgccaaaatatgagtatcatgcagtgagttgtt |
132 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||| ||||| |||||||||||||| |||||||||| ||| |
|
|
| T |
1737760 |
tagtcatgctatagcattgttgcgtagcggattcggaacaaatcgctgtttctttgtgatccgaaatcgaaaaaatatgagtatcttgcagtgagtagtt |
1737859 |
T |
 |
| Q |
133 |
ggattttgaaatataatgatattagagttgtttgtatattaggttatcgatctgttgatgaaaatattttcttgactgattattttacttgagaaatttg |
232 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
1737860 |
ggattttgaagtataatgacattagagttgtttgtatattaggtt----atctgttgatgaaaatattttcttgactggttattttacttaagaaatttg |
1737955 |
T |
 |
| Q |
233 |
cactagtgtttagcagggagtgagtagaactattaagttttgaaataac |
281 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
1737956 |
cactagtgtttagcagggagttagtagaactattaagttttgaaataac |
1738004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University