View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20614_low_19 (Length: 203)
Name: NF20614_low_19
Description: NF20614
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20614_low_19 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 82; Significance: 6e-39; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 82; E-Value: 6e-39
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 5975627 - 5975724
Alignment:
| Q |
1 |
aaacaaatttggatttcatgcattcaaggaatcttgaactcacgttgtcaggacctttgtagtcgttgatcaatcttaaatggtctaaagaatacaca |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
5975627 |
aaacaaatttggatttcatgcattcaaggaatcttgaactcacgttgtcaggacatttgcagtcgttgatcaatattagatggtctaaagaatacaca |
5975724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 173 - 203
Target Start/End: Complemental strand, 49122075 - 49122045
Alignment:
| Q |
173 |
ggtctcttaactataaagtgtctcaatttgg |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
49122075 |
ggtctcttaactataaagtgtctcaatttgg |
49122045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 173 - 203
Target Start/End: Original strand, 15850155 - 15850185
Alignment:
| Q |
173 |
ggtctcttaactataaagtgtctcaatttgg |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
15850155 |
ggtctcttaactataaagtgtctcaatttgg |
15850185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 174 - 203
Target Start/End: Original strand, 33129325 - 33129354
Alignment:
| Q |
174 |
gtctcttaactataaagtgtctcaatttgg |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
33129325 |
gtctcttaactataaagtgtctcaatttgg |
33129354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 175 - 203
Target Start/End: Original strand, 34616174 - 34616202
Alignment:
| Q |
175 |
tctcttaactataaagtgtctcaatttgg |
203 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
34616174 |
tctcttaactataaagtgtctcaatttgg |
34616202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University