View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20617_low_12 (Length: 300)
Name: NF20617_low_12
Description: NF20617
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20617_low_12 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 270; Significance: 1e-151; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 1 - 293
Target Start/End: Complemental strand, 7934933 - 7934640
Alignment:
| Q |
1 |
atcagtgtggacaattatgc-aaggccattgcatttatataatggatgtacataagacacaacaatgaaaaataagataatgatgaaacatttgtttgta |
99 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7934933 |
atcagtgtggacaattatgtgaaggccattgcatttatataatggatgtacataagacacaacaatgaaaaataagataatgatgaaacatttgtttgta |
7934834 |
T |
|
| Q |
100 |
atggagataaacattgttcccaacaaagcaaactatgcaaaacattggccttaacttttggttaaatattaattcatataatcatcataggtagtcacta |
199 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
7934833 |
atggagacaaacattgttcccaacaaagcaaactatgcaaaacattggccttaacttttggttaaatattaattcatataatcatcctaggtagtcacta |
7934734 |
T |
|
| Q |
200 |
aatggtatcttatgaccaattattattttttaatctaaaatctgaatcttatcgagaaacaaagaactcgtctatggaacatattgtaacaatg |
293 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
7934733 |
aatggtatcttatgaccaattattattttttaatctaaaatctgaatcttatcgagaaacaaagaactcgtctatggcacatattgtaacaatg |
7934640 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 253 - 300
Target Start/End: Complemental strand, 7934640 - 7934593
Alignment:
| Q |
253 |
gagaaacaaagaactcgtctatggaacatattgtaacaatggaatgaa |
300 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
7934640 |
gagaaacaaagaactcgtctatggcacatattgtaacaatggaatgaa |
7934593 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University