View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20617_low_17 (Length: 249)
Name: NF20617_low_17
Description: NF20617
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20617_low_17 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 26 - 243
Target Start/End: Original strand, 17658619 - 17658838
Alignment:
| Q |
26 |
cttgctctatgcgtcttgtgcagatgtagcggttaataaattttggttgtttnnnnnnnng--ctataacaggaaattgaattgatcttattggaatttt |
123 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||| |||||||||| |
|
|
| T |
17658619 |
cttgctctgtgcgtcttgtgcagatgtagcggttaataaattttggttgtttcaaaaaaaaaactataacaggaaattggattgatcttgttggaatttt |
17658718 |
T |
 |
| Q |
124 |
aggtgggttggatgtatggaacaatgacagaagatatactaactgggttgacgatacacaaaaaaggttggagatcggaattatgtacaccggatccaat |
223 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17658719 |
aggtgggttggatgtatggaacaatgactgaagatatactaactgggctgacgatacacaaaaaaggttggagatcggaattatgtacaccggatccaat |
17658818 |
T |
 |
| Q |
224 |
agccttcacaggttctgctc |
243 |
Q |
| |
|
|||||||||||||| ||||| |
|
|
| T |
17658819 |
agccttcacaggttgtgctc |
17658838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University