View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20617_low_18 (Length: 238)
Name: NF20617_low_18
Description: NF20617
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20617_low_18 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 9 - 238
Target Start/End: Original strand, 43175134 - 43175363
Alignment:
| Q |
9 |
acatcatcatcttaagtgtggtttttaagataatcgggatcaaagttaacattatttttaatgatttgacaatttatgatcggtaaattggttgactaca |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43175134 |
acatcatcatcttaagtgtggtttttaagataatcgggatcaaagttaacattatttttaatgatttgacaatttatgatcggtaaattggttgactaca |
43175233 |
T |
 |
| Q |
109 |
ctcaacgtgtatcaaaattagactcgtacgtaaatactgcaacaataaacgatattttttcttcaattttgataatgactttgtttgctttcttcccagt |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43175234 |
ctcaacgtgtatcaaaattagactcgtacgtaaatactgcaacaataaacgatattttttcttcaattttgataatgactttgtttgctttcttcccagt |
43175333 |
T |
 |
| Q |
209 |
tttacataactgagcaagctgggtgcttat |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
43175334 |
tttacataactgagcaagctgggtgcttat |
43175363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University