View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20618_high_106 (Length: 202)
Name: NF20618_high_106
Description: NF20618
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20618_high_106 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 105; Significance: 1e-52; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 28 - 191
Target Start/End: Original strand, 49861609 - 49861754
Alignment:
| Q |
28 |
ccgccattatcattctcttcgccgttatcataataatgctctgtctccattttctaattcgatactaccttctacgtgatcgcacacgtcaacacctccg |
127 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49861609 |
ccgccattatcattctcttcgccgttatcataataatgctctgtctccattttctaattcgatactaccttctacgtgatcgcacacgtcaacac----- |
49861703 |
T |
|
| Q |
128 |
ccgtaaccgccatctccgtcgtcaacctttcatcttttacgtggacccgtccgcccctgcttca |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49861704 |
-------------ctccgtcgtcaacctttcatcttttacgtggacccgtccgcccctgcttca |
49861754 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University