View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20618_high_106 (Length: 202)

Name: NF20618_high_106
Description: NF20618
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20618_high_106
NF20618_high_106
[»] chr4 (1 HSPs)
chr4 (28-191)||(49861609-49861754)


Alignment Details
Target: chr4 (Bit Score: 105; Significance: 1e-52; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 28 - 191
Target Start/End: Original strand, 49861609 - 49861754
Alignment:
28 ccgccattatcattctcttcgccgttatcataataatgctctgtctccattttctaattcgatactaccttctacgtgatcgcacacgtcaacacctccg 127  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||         
49861609 ccgccattatcattctcttcgccgttatcataataatgctctgtctccattttctaattcgatactaccttctacgtgatcgcacacgtcaacac----- 49861703  T
128 ccgtaaccgccatctccgtcgtcaacctttcatcttttacgtggacccgtccgcccctgcttca 191  Q
                 |||||||||||||||||||||||||||||||||||||||||||||||||||    
49861704 -------------ctccgtcgtcaacctttcatcttttacgtggacccgtccgcccctgcttca 49861754  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University