View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20618_high_44 (Length: 367)
Name: NF20618_high_44
Description: NF20618
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20618_high_44 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 231; Significance: 1e-127; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 92 - 362
Target Start/End: Original strand, 40883844 - 40884114
Alignment:
| Q |
92 |
gtagtaatcacactctgacaatctctcatcccgagtgttttggtgatttacaatgaaattaccctctcacaatctaccgatttcttttttgtttgttcat |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40883844 |
gtagtaatcacactctgacaatctctcatcccgagtgtttctgtgatttacaatgaaattaccctctcacaatctaccgatttcttttttgtttgttcat |
40883943 |
T |
 |
| Q |
192 |
ataaattagttaatcttcattatcaattgccaaaaatttcatgaccattgccaaaaatctcaccacaaaaatgaccctccacaatattgatgcaatgcat |
291 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
40883944 |
ataaattagttaatcttcattatcaattgccaaaaatttcatgaccattgccaaaaatctcaccacaaaaatgactctccacaatattgatgcaatgcat |
40884043 |
T |
 |
| Q |
292 |
gccgtgcttacttttgnnnnnnnnaaggaataaattaacgtgttttttgattttgtgactgtgtgtctgtg |
362 |
Q |
| |
|
|||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40884044 |
gccgtgattacttttgttttttttaaggaataaattaacgtgttttttgattttgtgactgtgtgtctgtg |
40884114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 19 - 57
Target Start/End: Original strand, 40883768 - 40883806
Alignment:
| Q |
19 |
ctccggaggccaacaatgtctttcttcagttaacaggag |
57 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
40883768 |
ctccggaggccaacaatgtctttcttcagttaagaggag |
40883806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 117; Significance: 2e-59; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 117; E-Value: 2e-59
Query Start/End: Original strand, 92 - 228
Target Start/End: Complemental strand, 8890678 - 8890542
Alignment:
| Q |
92 |
gtagtaatcacactctgacaatctctcatcccgagtgttttggtgatttacaatgaaattaccctctcacaatctaccgatttcttttttgtttgttcat |
191 |
Q |
| |
|
|||||||||| ||||| |||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
8890678 |
gtagtaatcaaactcttacaatctctcatcccgagtgctttggtgatttacgatgaaattaccctctcacaatctaccaatttcttttttgtttgttcat |
8890579 |
T |
 |
| Q |
192 |
ataaattagttaatcttcattatcaattgccaaaaat |
228 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8890578 |
ataaattagttaatcttcattatcaattgccaaaaat |
8890542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 238 - 305
Target Start/End: Complemental strand, 8890553 - 8890484
Alignment:
| Q |
238 |
attgccaaaaatctcaccacaaaaat--gaccctccacaatattgatgcaatgcatgccgtgcttacttt |
305 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||||||| |||||||||||||||| ||||||||||||||| |
|
|
| T |
8890553 |
attgccaaaaatctcaccacaataatatgaccctccaaaatattgatgcaatgcctgccgtgcttacttt |
8890484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 47; Significance: 9e-18; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 170 - 232
Target Start/End: Complemental strand, 41475169 - 41475107
Alignment:
| Q |
170 |
gatttcttttttgtttgttcatataaattagttaatcttcattatcaattgccaaaaatttca |
232 |
Q |
| |
|
|||||||||||||||||| |||||||||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
41475169 |
gatttcttttttgtttgtccatataaattgattaatcttcataatcaattgccaaaaatttca |
41475107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 169 - 232
Target Start/End: Original strand, 33358818 - 33358881
Alignment:
| Q |
169 |
cgatttcttttttgtttgttcatataaattagttaatcttcattatcaattgccaaaaatttca |
232 |
Q |
| |
|
|||||||| || ||||||| |||||||||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
33358818 |
cgatttctgttctgtttgtccatataaattgattaatcttcataatcaattgccaaaaatttca |
33358881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 238 - 289
Target Start/End: Complemental strand, 41475122 - 41475071
Alignment:
| Q |
238 |
attgccaaaaatctcaccacaaaaatgaccctccacaatattgatgcaatgc |
289 |
Q |
| |
|
|||||||||||| |||||| | ||||||||||||||||| || ||||||||| |
|
|
| T |
41475122 |
attgccaaaaatttcaccaaataaatgaccctccacaatcttcatgcaatgc |
41475071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 44; Significance: 6e-16; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 169 - 232
Target Start/End: Original strand, 10209086 - 10209149
Alignment:
| Q |
169 |
cgatttcttttttgtttgttcatataaattagttaatcttcattatcaattgccaaaaatttca |
232 |
Q |
| |
|
||||||||||| ||||||| |||||||||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
10209086 |
cgatttcttttctgtttgtccatataaattgattaatcttcataatcaattgccaaaaatttca |
10209149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 170 - 232
Target Start/End: Complemental strand, 48117958 - 48117896
Alignment:
| Q |
170 |
gatttcttttttgtttgttcatataaattagttaatcttcattatcaattgccaaaaatttca |
232 |
Q |
| |
|
|||||||||| ||| ||| |||||||||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
48117958 |
gatttcttttctgtctgtccatataaattgattaatcttcataatcaattgccaaaaatttca |
48117896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University