View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20618_high_51 (Length: 351)
Name: NF20618_high_51
Description: NF20618
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20618_high_51 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 306; Significance: 1e-172; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 306; E-Value: 1e-172
Query Start/End: Original strand, 21 - 338
Target Start/End: Complemental strand, 24860596 - 24860279
Alignment:
| Q |
21 |
atggttgttgttttcaacaagaaatccgtaatggaacaacttcatgaattgaagtacataaatctctatatgatattgtgatttgataaattggaaattg |
120 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||| |
|
|
| T |
24860596 |
atggttgttattttcaacaagaaatccgtaatggaacaacttcatgaattgaagtacataaatctctacatgatattgtgatttgattaattggaaattg |
24860497 |
T |
 |
| Q |
121 |
aaaaatgacagggaaattgatgccggatgcttcattgaacccaacaagtttggttgtgggtgccattgcaagtgcttttgctctgtcttctgttttgtac |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24860496 |
aaaaatgacagggaaattgatgccggatgcttcattgaacccaacaagtttggttgtgggtgccattgcaagtgcttttgctctgtcttctgttttgtac |
24860397 |
T |
 |
| Q |
221 |
attgcatgggacatctctggtggacatgtcaatcctgctgtgacctttgcaatggctgtgggaggacatattagtgtcccaactgctctcttttattggg |
320 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24860396 |
attgcatgggacatctctggtggacatgtcaatcctgctgtgacctttgcaatggctgtgggaggacatattagtgtcccaactgctctcttttattggg |
24860297 |
T |
 |
| Q |
321 |
ttgctcaacttattgcct |
338 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
24860296 |
ttgctcaacttattgcct |
24860279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University